UNITE logo

Communication and identification of DNA based fungal species
UNITE sequence: UDB015054 | UK721
Sequence (1825 bp)CCTGTAGTGACTGCGGATGATCATTAATGAAATCGACGTTCGGGAAAGGTTGTTGCTGGCCCCACGGCATGTGCACGCCTTTACCGGATG TATTCGTCCTTTCTTTACACCTGTGCACGATCTGTAGCTAGGGATGATCACGGAGCCTGTCGGTTCCGAATGCCCTGGCTATGAACGTTT TTATACCCTCTTATAAAGTTTTTTTTGAATGTTTGTCCTGCGTGTAACAGCGCGAATGAAATACAACTTTCAGCAACGGATCTCTTGGCT CTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGC TCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACTGCTTCGGCTTTGTTCGAAGTGAAGTTGGACGTGAAGCG CTTGCTGGCCTGTTCCGGCTCCTTCCAAAAGCATAAAGCCTTTTCTCAGTAGATCTTGGCAGAAAAAGTATCTTTGACGTGATAATCATC TACGTCGCAGAGAAAGCCTTGAGCAGAGCTCTTCTTTGTTCTTGTGATGAGGAAGGCTCCTACGGGATGGCTCACCTGGAGGGGGGTTAT CATATGATCCCTTTCGTTTGACCAATTCGACCTCAAATCAGGCAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAA ACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCTGGCGTGCCTCTGGCCGTCCGAGTTGTAGTC TGGAGAAGCGTCTTCCGTGCTGGACCGTGTACAAGTCCCTTGGAACAGGGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTAC CAGCGCTTTGTGATGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGG CGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGG AAACGCTTGAAGTCAGTCGCGTCTGCCAGGACTCAGCCTCGCTTCTGCTTGGTGCACTTTCTGGTTGACGGGCCAGCATCGATTTCGATC GTCAGAAAAAGTAGGAGGGAATGTGGCACCTTTCGAGGTGTGTTATAGCCCTCCATCGCATATGACGGTTGGGATCGAGGACCGCAGCAC GCCTTTATGGGCTGGGGCTTTGCTCTCATACGTGCTTAGGATGCTGGCTTAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGA GTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGATAGTTGAGACCTCTACCATGGAGGGCATCGACGCC TGGACTTGATCTACGGAGACGGTTCCACGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAG AGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCT AGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGATAGCAGAAACTCGTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTT GAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGACGAGCCGTCACTTGATTGGACCGCTCGCGATGAAGTTAGTGGGGGGGGC GCCTTTTATATAGGCTCCGGGGCGC
Sequenced regionsITS1, 5.8S, ITS2, LSU rDNA
UNITE taxon nameHydnellum peckii Banker, 1912
EcM lineage/hydnellum-sarcodon
Linked to (source)TU108088 (Specimen) 
Sampling areaCanada
Collected byUrmas Kõljalg
Collected date10.09.2008

Last updated by: Leho Tedersoo, 19.12.2013 11:10
More information about this sequence and annotation options are available in PlutoF

UNITE Species Hypotheses
SH codeTaxon nameThreshold (%)No. of seqsRefSeq chosen by
SH005372.07FUHydnellum peckii3.033Urmas Kõljalg
SH142650.07FUHydnellum peckii2.533Urmas Kõljalg
SH040786.07FUHydnellum peckii2.033Urmas Kõljalg
SH182302.07FUHydnellum peckii1.532Urmas Kõljalg
SH086373.07FUHydnellum peckii1.027Urmas Kõljalg
SH237204.07FUHydnellum peckii0.53
SH330424.07FUHydnellum peckii0.01