UNITE logo

Communication and identification of DNA based fungal species
UNITE sequence: UDB015054 | UK721
Sequence (1825 bp)CCTGTAGTGACTGCGGATGATCATTAATGAAATCGACGTTCGGGAAAGGTTGTTGCTGGCCCCACGGCATGTGCACGCCTTTACCGGATG TATTCGTCCTTTCTTTACACCTGTGCACGATCTGTAGCTAGGGATGATCACGGAGCCTGTCGGTTCCGAATGCCCTGGCTATGAACGTTT TTATACCCTCTTATAAAGTTTTTTTTGAATGTTTGTCCTGCGTGTAACAGCGCGAATGAAATACAACTTTCAGCAACGGATCTCTTGGCT CTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGC TCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACTGCTTCGGCTTTGTTCGAAGTGAAGTTGGACGTGAAGCG CTTGCTGGCCTGTTCCGGCTCCTTCCAAAAGCATAAAGCCTTTTCTCAGTAGATCTTGGCAGAAAAAGTATCTTTGACGTGATAATCATC TACGTCGCAGAGAAAGCCTTGAGCAGAGCTCTTCTTTGTTCTTGTGATGAGGAAGGCTCCTACGGGATGGCTCACCTGGAGGGGGGTTAT CATATGATCCCTTTCGTTTGACCAATTCGACCTCAAATCAGGCAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAA ACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCTGGCGTGCCTCTGGCCGTCCGAGTTGTAGTC TGGAGAAGCGTCTTCCGTGCTGGACCGTGTACAAGTCCCTTGGAACAGGGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTAC CAGCGCTTTGTGATGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGG CGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGG AAACGCTTGAAGTCAGTCGCGTCTGCCAGGACTCAGCCTCGCTTCTGCTTGGTGCACTTTCTGGTTGACGGGCCAGCATCGATTTCGATC GTCAGAAAAAGTAGGAGGGAATGTGGCACCTTTCGAGGTGTGTTATAGCCCTCCATCGCATATGACGGTTGGGATCGAGGACCGCAGCAC GCCTTTATGGGCTGGGGCTTTGCTCTCATACGTGCTTAGGATGCTGGCTTAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAGGA GTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGATAGTTGAGACCTCTACCATGGAGGGCATCGACGCC TGGACTTGATCTACGGAGACGGTTCCACGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAG AGGAAACTCTGGTGGAAGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCT AGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGATAGCAGAAACTCGTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTT GAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGACGAGCCGTCACTTGATTGGACCGCTCGCGATGAAGTTAGTGGGGGGGGC GCCTTTTATATAGGCTCCGGGGCGC
Sequenced regionsITS1, 5.8S, ITS2, LSU rDNA
UNITE taxon nameHydnellum peckii Banker, 1912
EcM lineage/hydnellum-sarcodon
Linked to (source)TU108088 (Specimen) 
Sampling areaCanada
Collected byUrmas Kõljalg
Collected date10.09.2008

Last updated by: Leho Tedersoo, 19.12.2013 11:10
More information about this sequence and annotation options are available in PlutoF

UNITE Species Hypotheses
SH codeTaxon nameThreshold (%)No. of seqsRefSeq chosen by
SH1233802.08FUHydnellum peckii3.035Urmas Kõljalg
SH1352585.08FUHydnellum peckii2.535Urmas Kõljalg
SH1487263.08FUHydnellum peckii2.035Urmas Kõljalg
SH1644050.08FUHydnellum peckii1.535Urmas Kõljalg
SH1835800.08FUHydnellum peckii1.028Urmas Kõljalg
SH2096641.08FUHydnellum peckii0.53
SH2557655.08FUHydnellum peckii0.01