UNITE logo

Communication and identification of DNA based fungal species
INSD sequence: GenBank: HM485392 | ENA: HM485392
StudyBonito,G.M., Gryganskyi,A.P., Trappe,J.M. and Vilgalys,R.; A global meta-analysis of Tuber ITS rDNA sequences: species diversity, host associations and long-distance dispersal; Mol. Ecol. 19 (22), 4994-5008 (2010)
Sequence (560 bp)CATTATTATAATGCGTGGAAATGCCCCTAATAAGGGCATACTCTATAAAACTCTAAACTTACTGTCTGAGAAGGCCACGTGCCGTAATCT TTAAACATTTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAG AATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCATAGGGCATGCCTGTTCGAGCGTCACTAACAACCCCAT CATACAAGAGTGTGGTATTGGCAGAAGTGGGTAGGGCTAGCAGTGCTGGTCCCACTCTGCTGGAATGAATAGGCCGGAAATGCAGACCAT GGCAACAAACTTTCAGAGTATTTTGAAATGCTAAATTAGTTTGGAGCTGGTCAGAATCCAGGCCATTGGACCCCCATTCTGTGTAAAGCA GTAATGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAG TAACGGCGAGTGAAGCGGCA
Sequenced regionsITS1, 5.8S, ITS2
UNITE taxon nameTuber whetstonense J.L. Frank, D. Southw. & Trappe, 2006
EcM lineage/tuber-helvella
Sequence sourceFruitbody
Linked to (source)OSC:111919 (Specimen) 
Sampling areaUnited States

Last updated by: plutof, 04.08.2016 14:23
More information about this sequence and annotation options are available in PlutoF

UNITE Species Hypotheses
SH codeTaxon nameThreshold (%)No. of seqsRefSeq chosen by
SH001616.07FUTuber whetstonense3.08Matthew E. Smith
SH138371.07FUTuber whetstonense2.58Matthew E. Smith
SH035920.07FUTuber whetstonense2.08Matthew E. Smith
SH176601.07FUTuber whetstonense1.58Matthew E. Smith
SH079389.07FUTuber whetstonense1.05Matthew E. Smith
SH227554.07FUTuber whetstonense0.52Matthew E. Smith
SH313221.07FUTuber whetstonense0.01
Original INSD data
OrganismTuber whetstonense
LineageEukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Pezizomycetes; Pezizales; Tuberaceae; Tuber
Sourceascocarp
IsolateJT25783
LocalityOregon
CountryUSA
Date2016-04-11