UNITE logo

Communication and identification of DNA based fungal species
INSD sequence: GenBank: GQ221620 | ENA: GQ221620
StudyWolfe BE, Richard F, Cross HB, Pringle A. 2010. Distribution and abundance of the introduced ectomycorrhizal fungus Amanita phalloides in North America. New Phytol. 185: 803-816.
Sequence (535 bp)AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTATAATGCGTGGAAATGCCCCTAATAAGGGCATACTCTATAAA ACTCTAAACTTACTGTCTGAGAAGGCCATGTGCCGTAATCTTTAAACATTTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGA TGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTAT TCCATAGGGCATGCCTGTTCGAGCGTCACTAACAACCCCATCACATAATAGTGTGGTATTGGCAGAAGTGGGTAGGGCTAGCAGTGCTGG CCCCACTCTGCTGGAATGAATAGGCCGGAAATGCAGACCATGGCAACAAACTTTCAGAGTATTTTGAAATGCTAAATTAGTTTGGAGCTG GTCAGAATCCAGGCCATTGGACCCCCATTCTGTGTAAAGCAGTAATGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA
Sequenced regionsITS1, 5.8S, ITS2
UNITE taxon nameTuber P. Micheli ex F.H. Wigg., 1780
EcM lineage/tuber-helvella
Sequence sourceEctomycorrhiza
Sampling areaUnited States

Last updated by: plutof, 02.06.2016 05:40
More information about this sequence and annotation options are available in PlutoF

UNITE Species Hypotheses
SH codeTaxon nameThreshold (%)No. of seqsRefSeq chosen by
SH001616.07FUTuber whetstonense3.08Matthew E. Smith
SH138371.07FUTuber whetstonense2.58Matthew E. Smith
SH035920.07FUTuber whetstonense2.08Matthew E. Smith
SH176601.07FUTuber whetstonense1.58Matthew E. Smith
SH079406.07FUTuber1.02
SH227576.07FUTuber0.52
SH313242.07FUTuber0.01
Original INSD data
Organismuncultured Tuber
LineageEukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Pezizomycetes; Pezizales; Tuberaceae; environmental samples
Sourceroots from soil in Pseudotsuga-Quercus-Lithocarpus forest
CloneOTU3
LocalityPoint Reyes National Seashore, Marin County, California
CountryUSA
Date2010-03-17