UNITE logo

Communication and identification of DNA based fungal species
INSD sequence: GenBank: JF419244 | ENA: JF419244
StudyGuevara,G., Bonito,G.M., Cazares,E., Williams,G., Healy,R.A., Vilgalys,R. and Trappe,J.; New species of North American Tuber (Tuberaceae, Pezizales) documented from fruitbodies and ectomycorrhizas; Unpublished
Sequence (459 bp)CATTATTATAATGCGTGGAARTGCCCCTAATAAGGGCATACTCTATAAAACTCTAAACTTACTGTCTGAGAAGGCCACGTGCCGTAATCT TTAAACATTTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAG AATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCATAGGGCATGCCTGTTCGAGCGTCACTGACAACCCCAT CATACAAGAGTGTGGTATTGGCAGAAGTGGGTAGGGCTAGCAGTGCTGGTCCCACTCTGCTGGAATGAATAGGCCGGAAATGCAGACCAT GGCAACAAACTTTCRGAGTATTTTGAAATGCTAAATTAGTTTGGAGCTGGTCAGAATCCAGGCTATCGGACCCCCATTCTGTGTAAAGCA GTAATGTTG
Sequenced regionsITS1, 5.8S, ITS2
Remarksectomycorrhiza of Quercus wislizeni
UNITE taxon nameTuber whetstonense J.L. Frank, D. Southw. & Trappe, 2006
EcM lineage/tuber-helvella
Sampling areaUnited States

Last updated by: plutof, 24.04.2019 14:16
More information about this sequence and annotation options are available in PlutoF

UNITE Species Hypotheses
SH codeTaxon nameThreshold (%)No. of seqsRefSeq chosen by
SH1236788.08FUTuber whetstonense3.08Matthew E. Smith
SH1355888.08FUTuber whetstonense2.58Matthew E. Smith
SH1491004.08FUTuber whetstonense2.08Matthew E. Smith
SH1648387.08FUTuber whetstonense1.58Matthew E. Smith
SH1841152.08FUTuber whetstonense1.05Matthew E. Smith
SH2104108.08FUTuber whetstonense0.52
SH2572136.08FUTuber whetstonense0.01
Original INSD data
OrganismTuber whetstonense
LineageEukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Pezizomycetes; Pezizales; Tuberaceae; Tuber
Sourceectomycorrhiza
StrainLO8B
LocalityCalifornia
CountryUSA
Date2018-09-20