UNITE logo

Communication and identification of DNA based fungal species
INSD sequence: GenBank: KP276269 | ENA: KP276269
StudyNguyen,N.H. and Bruns,T.D.; Direct Submission; Submitted (15-DEC-2014) Plant Biology, University of Minnesota, 1445 Gortner Ave, St. Paul, MN 55108, USA
Sequence (528 bp)CCTGCGGAAGGATCATTATTATAATGCGTGGAAATGCCCCTAATAAGGGCATACTCTATAAAACTCTAAACTTACTGTCTGAGAAGGCCA TGTGCCGTAATCTTTAAACATTTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTA ATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCATAGGGCATGNCTGTTCGAGCGTCA CTAACAACCCCATCACATAATAGTGTGGTATTGGCAGAAGTGGGTAGGGCTAGCAGTGCTGGCCCCACTCTGCTGGAATGAATAGGCCGG AAATGCAGACCATGGCAACAAACTTTCAGAGTATTTTGAAATGCTAAATTAGTTTGGAGCTGGTCAGAATCCAGGCCATTGGACCCCCAT TCTGTGTAAAGCAGTAATGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA
Sequenced regionsITS1, 5.8S, ITS2
UNITE taxon nameTuber P. Micheli ex F.H. Wigg., 1780
EcM lineage/tuber-helvella
Sampling areaUnited States

Last updated by: plutof, 31.05.2016 21:19
More information about this sequence and annotation options are available in PlutoF

UNITE Species Hypotheses
SH codeTaxon nameThreshold (%)No. of seqsRefSeq chosen by
SH001616.07FUTuber whetstonense3.08Matthew E. Smith
SH138371.07FUTuber whetstonense2.58Matthew E. Smith
SH035920.07FUTuber whetstonense2.08Matthew E. Smith
SH176601.07FUTuber whetstonense1.58Matthew E. Smith
SH079406.07FUTuber1.02
SH227576.07FUTuber0.52
SH617292.07FUTuber0.01
Original INSD data
Organismuncultured Tuber
LineageEukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Pezizomycetes; Pezizales; Tuberaceae; environmental samples
HostPinus muricata
Sourceectomycorrhizal root-tip
CloneF41
LocalityCA, Marin Co., National Seashore, along Limantour Road
Geo-coordinates38.0586 N 122.8495 W
CountryUSA
Date2015-03-01