UNITE logo

Communication and identification of DNA based fungal species
INSD sequence: GenBank: EF411131 | ENA: EF411131
StudyMorris,M.H., Smith,M.E., Rizzo,D.M., Rejmanek,M. and Bledsoe,C.S.; Contrasting ectomycorrhizal fungal communities on the roots of co-occurring oaks (Quercus spp.) in a California woodland; New Phytol. 178 (1), 167-176 (2008)
Sequence (699 bp)AGGATCATTATTATAATGCGTGGAAATGCCCCTAATAAGGGCATACTCTATAAAACTCTAAACTTACTGTCTGAGAAGGCCACGTGCCGT AATCTTTAAACATTTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCATAGGGCATGCCTGTTCGAGCGTCACTGACAAC CCCATCATACAAGAGTGTGGTATTGGCAGAAGTGGGTAGGGCTAGCAGTGCTGGTCCCACTCTGCTGGAATGAATAGGCCGGAAATGCAG ACCATGGCAACAAACTTTCAGAGTATTTTGAAATGCTAAATTAGTTTGGAGCTGGTCAGAATCCAGGCTATCGGACCCCCATTCTGTGTA AAGCAGTAATGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGC CTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGACACCTCTGGTGTTCGAGTTGTAATTTGGAGAGGCATCTTCTGG AGGGGCCCAGCCTATGTGCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACTTGGCTGGATGT
Sequenced regionsITS1, 5.8S, ITS2
UNITE taxon nameTuber P. Micheli ex F.H. Wigg., 1780
EcM lineage/tuber-helvella
Sequence sourceEctomycorrhiza
Linked to (source)sample (Material Sample)
Sampling areaUnited States

Last updated by: plutof, 02.06.2016 08:11
More information about this sequence and annotation options are available in PlutoF

UNITE Species Hypotheses
SH codeTaxon nameThreshold (%)No. of seqsRefSeq chosen by
SH1236788.08FUTuber whetstonense3.08Matthew E. Smith
SH1355888.08FUTuber whetstonense2.58Matthew E. Smith
SH1491004.08FUTuber whetstonense2.08Matthew E. Smith
SH1648387.08FUTuber whetstonense1.58Matthew E. Smith
SH1841152.08FUTuber whetstonense1.05Matthew E. Smith
SH2104108.08FUTuber whetstonense0.52
SH2572130.08FUTuber0.01
Original INSD data
Organismuncultured Tuber
LineageEukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Pezizomycetes; Pezizales; Tuberaceae; environmental samples
HostQuercus wislizeni
Tissue typeectomycorrhizal root tip
CloneL8BA7
Date2008-03-14