UNITE logo

Communication and identification of DNA based fungal species
INSD sequence: GenBank: EF411131 | ENA: EF411131
StudyMorris,M.H., Smith,M.E., Rizzo,D.M., Rejmanek,M. and Bledsoe,C.S.; Contrasting ectomycorrhizal fungal communities on the roots of co-occurring oaks (Quercus spp.) in a California woodland; New Phytol. 178 (1), 167-176 (2008)
Sequence (699 bp)AGGATCATTATTATAATGCGTGGAAATGCCCCTAATAAGGGCATACTCTATAAAACTCTAAACTTACTGTCTGAGAAGGCCACGTGCCGT AATCTTTAAACATTTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCATAGGGCATGCCTGTTCGAGCGTCACTGACAAC CCCATCATACAAGAGTGTGGTATTGGCAGAAGTGGGTAGGGCTAGCAGTGCTGGTCCCACTCTGCTGGAATGAATAGGCCGGAAATGCAG ACCATGGCAACAAACTTTCAGAGTATTTTGAAATGCTAAATTAGTTTGGAGCTGGTCAGAATCCAGGCTATCGGACCCCCATTCTGTGTA AAGCAGTAATGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGC CTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGACACCTCTGGTGTTCGAGTTGTAATTTGGAGAGGCATCTTCTGG AGGGGCCCAGCCTATGTGCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACTTGGCTGGATGT
Sequenced regionsITS1, 5.8S, ITS2
UNITE taxon nameTuber P. Micheli ex F.H. Wigg., 1780
EcM lineage/tuber-helvella
Sequence sourceEctomycorrhiza
Linked to (source)sample (Material Sample)
Sampling areaUnited States

Last updated by: plutof, 02.06.2016 08:11
More information about this sequence and annotation options are available in PlutoF

UNITE Species Hypotheses
SH codeTaxon nameThreshold (%)No. of seqsRefSeq chosen by
SH001616.07FUTuber whetstonense3.08Matthew E. Smith
SH138371.07FUTuber whetstonense2.58Matthew E. Smith
SH035920.07FUTuber whetstonense2.08Matthew E. Smith
SH176601.07FUTuber whetstonense1.58Matthew E. Smith
SH079389.07FUTuber whetstonense1.05Matthew E. Smith
SH227551.07FUTuber whetstonense0.52
SH313211.07FUTuber0.01
Original INSD data
Organismuncultured Tuber
LineageEukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Pezizomycetes; Pezizales; Tuberaceae; environmental samples
HostQuercus wislizeni
Tissue typeectomycorrhizal root tip
CloneL8BA7
Date2008-03-14