UNITE logo

Communication and identification of DNA based fungal species
INSD sequence: GenBank: EF559286 | ENA: EF559286
StudySmith,M.E., Douhan,G.W. and Rizzo,D.M.; Intra-specific and intra-sporocarp ITS variation of ectomycorrhizal fungi as assessed by rDNA sequencing of sporocarps and pooled ectomycorrhizal roots from a Quercus woodland; Mycorrhiza 18 (1), 15-22 (2007)
Sequence (636 bp)AGGATCATTATTATAATGCGTGGAAATGCCCCTAATAAGGGNANACNCTATAAAACTCTAAACTTACTGTCTGAGAAGGCCANGTGCCGT AATCTTTAAACATTTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCACCCTTTGGTATTCCATAGGGCATGCCTGTTCGAGCGTCACTGACAAC CCCATCATACAAGAGTGTGGTATTGGCAGAAGTGGGTAGGGCTAGCAGTGCTGGTCCCACTCTGCTGGAATGAATAGGCCGGAAATGCAG ACCATGGCAACAAACTTTCAGAGTATTTTCAAATGCTAAATTAGTTTGGAGCTGGTCAGAATCCAGGCTATCGGACCCCCATTCTGTGTA AAGCAGTAATGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGC CTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGACACCTCTGGTGTTCGAGTTGTAATTTGGAGAGGCATCTTCTGG AGGGGC
Sequenced regionsITS1, 5.8S, ITS2
UNITE taxon nameTuber P. Micheli ex F.H. Wigg., 1780
EcM lineage/tuber-helvella
Sequence sourceEctomycorrhiza
Linked to (source)sample (Material Sample)
Sampling areaUnited States

Last updated by: plutof, 02.06.2016 08:13
More information about this sequence and annotation options are available in PlutoF

UNITE Species Hypotheses
SH codeTaxon nameThreshold (%)No. of seqsRefSeq chosen by
SH001616.07FUTuber whetstonense3.08Matthew E. Smith
SH138371.07FUTuber whetstonense2.58Matthew E. Smith
SH035920.07FUTuber whetstonense2.08Matthew E. Smith
SH176601.07FUTuber whetstonense1.58Matthew E. Smith
SH079402.07FUTuber1.01
SH227566.07FUTuber0.51
SH313213.07FUTuber0.01
Original INSD data
Organismuncultured Tuberaceae
LineageEukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Pezizomycetes; Pezizales; Tuberaceae; environmental samples
Sourceectomycorrhizal root tip
Clonebg1d_c6
Date2007-11-26