UNITE logo

Communication and identification of DNA based fungal species
INSD sequence: GenBank: DQ974800 | ENA: DQ974800
StudySmith,M.E., Douhan,G.W. and Rizzo,D.M.; Ectomycorrhizal community structure in a xeric Quercus woodland based on rDNA sequence analysis of sporocarps and pooled roots; New Phytol. 174 (4), 847-863 (2007)
Sequence (637 bp)AGGATCATTATTATAATGCGTGGAAATGCCCCTAATAAGGGCATACTCTATAAAACTCTAAACTTACTGTCTGAGAAGGCCACGTGNNGT AATCTTTAAACATTTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCATAGGGCATGCCTGTTCGAGCGTCACTAACAAC CCCATCATACAAGAGTGTGGTATTGGCAGAAGTGGGTAGGGCTAGCAGTGCTGGTCCCACTCTGCTGGAATGAATAGGCCGGAAATGCAG ACCATGGCAACAAACTTTCAGAGTATTTTGAAATGCTAAATTAGTTTGGAGCTGGTCAGAATCCAGGCTATTGGACCCCCATTCTGTGTA AAGCAGTAATGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGC CTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGACACCTCTGGTGTTCGAGTTGTAATTTGGAGAGGCATCTTCTGG AGGGGCC
Sequenced regionsITS1, 5.8S, ITS2
UNITE taxon nameTuber P. Micheli ex F.H. Wigg., 1780
EcM lineage/tuber-helvella
Sequence sourceEctomycorrhiza
Linked to (source)sample (Material Sample)
Sampling areaUnited States

Last updated by: plutof, 06.09.2018 03:59
More information about this sequence and annotation options are available in PlutoF

UNITE Species Hypotheses
SH codeTaxon nameThreshold (%)No. of seqsRefSeq chosen by
SH1236788.08FUTuber whetstonense3.08Matthew E. Smith
SH1355888.08FUTuber whetstonense2.58Matthew E. Smith
SH1491004.08FUTuber whetstonense2.08Matthew E. Smith
SH1648387.08FUTuber whetstonense1.58Matthew E. Smith
SH1841152.08FUTuber whetstonense1.05Matthew E. Smith
SH2104125.08FUTuber0.51
SH2572133.08FUTuber0.01
Original INSD data
Organismuncultured Tuber
LineageEukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Pezizomycetes; Pezizales; Tuberaceae; environmental samples
HostQuercus douglasii
Sourceectomycorrhizal root tip
Clonebg15c
Date2018-01-08