UNITE logo

Communication and identification of DNA based fungal species
INSD sequence: GenBank: AY830855 | ENA: AY830855
StudyFrank,J.L., Barry,S. and Southworth,D.; Mammal mycophagy and dispersal of mycorrhizal inoculum in Oregon white oak woodlands; Northwest Sci. 80, 264-273 (2006)
Sequence (572 bp)GAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTATAATGCGTGGAAATGCCCCTAATAAGGGCAT ACTCTATAAAACTCTAAACTTACTGTCTGAGAAGGCCACGTGCCGTAATCTTTAAACATTTTAAAACTTTCAACAACGGATCTCTTGGTT CTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGC CCTTTGGTATTCCATAGGGCATGCCTGTTCGAGCGTCACTAATAACCCCATCATACAAGAGTGTGGTATTGGCAGAAGTGGGTAGGGCTA GCAGTGCTGGTCCCACTCTGCTGGAATGAATAGGCCGGAAATGCAGACCATGGCAACAAACTTTCAGAGTATTTTGAAATGCTAAATTAG TTTGGAGCTGGTCGGAATCCAGGCCATTGGACCCCCATTCTGTGTAAAGCAGTAATGTTGACCTCGGATCAGGTAGGGATACCCGCCTGA AACTTAAGCATATCAATTAAAGCGGGAGGAAA
Sequenced regionsITS1, 5.8S, ITS2
UNITE taxon nameTuber whetstonense J.L. Frank, D. Southw. & Trappe, 2006
EcM lineage/tuber-helvella
Sequence sourceFruitbody
Linked to (source)SOC756 (Specimen) 
Sampling areaUnited States

Last updated by: plutof, 02.06.2016 10:21
More information about this sequence and annotation options are available in PlutoF

UNITE Species Hypotheses
SH codeTaxon nameThreshold (%)No. of seqsRefSeq chosen by
SH001616.07FUTuber whetstonense3.08Matthew E. Smith
SH138371.07FUTuber whetstonense2.58Matthew E. Smith
SH035920.07FUTuber whetstonense2.08Matthew E. Smith
SH176601.07FUTuber whetstonense1.58Matthew E. Smith
SH079389.07FUTuber whetstonense1.05Matthew E. Smith
SH227554.07FUTuber whetstonense0.52Matthew E. Smith
SH313243.07FUTuber whetstonense0.01Matthew E. Smith
Original INSD data
OrganismTuber whetstonense
LineageEukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Pezizomycetes; Pezizales; Tuberaceae; Tuber
Specimen voucherSOC 756
Date2008-09-29