UNITE logo

Communication and identification of DNA based fungal species
TH003325: Lepiota echinella Quél. & G.E. Bernard | SH177775.07FU | DOI: 10.15156/BIO/SH177775.07FU | New version of this SH is available: SH1510102.08FU

Distance to the closest SH: 1.5
No. of sequences in SH: 2

Placement in the fungal classification
Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Agaricales; Agaricaceae; Lepiota
Index Fungorum: urn:lsid:indexfungorum.org:names:146411

Reference sequence: AY176366
Chosen by: Irja Saar
Date: 2014-11-09 22:05

Newer version(s) of this SH is/are available
SH code (Count*/Total count**)
SH1510102.08FU (2/2);
*Number of sequences carried over from pervious version
**Total number of sequences composing this SH in current version
Older version(s) of this SH is/are available
SH code (Count*/Total count**)
SH203620.06FU (2/2);
*Number of sequences carried over from previous version
**Total number of sequences composing this SH in current version
Distribution map
*Locations without exact coordinates are displayed as spherical country centroids
% 
                                                           |50                                                      |100                                                      |150                                                      |200                                                      |250                                                      |300                                                      |350                                                      |400                                                      |450                                                      |500                                                      |550                                                      |600                                                      |650
Accession numberUNITE taxon nameINSD taxon nameSequence sourceInteracting taxaSampling area<.50.51.01.52.02.53.0  Alignment  
AY176366Lepiota echinellaLepiota echinella (Lepiota echinell...Belgium              gtgaacctgcggaaggatcattattgaattaagcaatggtgggttgtagctggctcctcggagca-tgtgcacacctgctgtct-taatccatccccctgtgcaccttttgtagtcctgttgggaagaatgactggacctccctcatcgtgggagaggcttggcctgaaccccctcccggtctatgtattttccatataccatgtagcatgttgcagaatgtaatcaatgggcctctgtgcctttagaaatctatacaactttcagcaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgctccttggtattccgaagagcatgcctgtttgagtgtcattaaatcctcaatccc-ttccggtcgtcacagaccgggtagtggcttggatgttggaggctcctgctggccctcatttgctgggtcggctcctctgaaatgcattagcggaaccgtttgcggtctgtcactggtgtgataattatctacaccgaggctgccgctctctgtc-ttgttcagcttctaatcgtctcttcgtagacaacagtcgaatgtttgacctcaaatcaggtagg------a
FJ998397Lepiota echinellaLepiota echinella (Lepiota echinell...              ---aacctgcggaaggatcattattgaattaagcaatggtgggttgtagctggatcctcggagca-tgtgcacacctgctgtct-taatccatccccctgtgcaccttttgtagtcctgttgggaagaatgactggacctccctcatcgtgggagaggcttggcctgaaccccct-ccggtctatgtattttccatataccatgtagcatgttgcagaatgtgatcaatgggcctctgtgcctttagaaatctatacaactttcagcaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgctccttggtattccgaggagcatgcctgtttgagtgtcattaaatcctcaatccc-ttccggtcgtcacagactgggtagtggcttggatgttggaggctcctgctggccctcatttgctgggtcagctcctctgaaatgcattagcggaaccgtttgcggtctgtcactggtgtgataattatctacaccgaggctgccgctctctgtc-ttgttcagcttctaatcgtctctttgtagacaacagtcgaatg----------------------------
** - sequence was added after initial calculation of SH-s; (x) - there are x duplicates for this sequence; - click to see the extended view of this SH (all sequences listed)