UNITE logo

Communication and identification of DNA based fungal species
TH003325: Lepiota (Pers.) Gray | SH467833.07FU | DOI: 10.15156/BIO/SH467833.07FU | New version of this SH is available: SH1529935.08FU

Distance to the closest SH: 1.5
No. of sequences in SH: 3

Placement in the fungal classification
Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Agaricales; Agaricaceae
Index Fungorum: urn:lsid:indexfungorum.org:names:17938

Representative sequence: KP348285
Chosen by: automatically by the program
Date: 2013-11-19

Distribution of distances 
SH graph
Newer version(s) of this SH is/are available
SH code (Count*/Total count**)
SH1529935.08FU (3/3);
*Number of sequences carried over from pervious version
**Total number of sequences composing this SH in current version
Older version(s) of this SH is/are available
SH code (Count*/Total count**)
SH203622.06FU (1/3);
*Number of sequences carried over from previous version
**Total number of sequences composing this SH in current version
Distribution map
*Locations without exact coordinates are displayed as spherical country centroids
% 
                                                           |50                                                      |100                                                      |150                                                      |200                                                      |250                                                      |300                                                      |350                                                      |400                                                      |450                                                      |500                                                      |550                                                      |600
Accession numberUNITE taxon nameINSD taxon nameSequence sourceInteracting taxaSampling area<.50.51.01.52.02.53.0  Alignment  
JN224824LepiotaLepiota (Lepiota sp. MFLU 09-0120)Thailand              gtgaacctgcggaaggatcattattgaaaagcaatagtgggttgtagctggctccttggagcatgtgcacgcctgctgtcttaatccatccacctgtgcatcatttgtagtcctgtgggtagtgtggctgaatcctcattgttgggtttggtctgattctctcaggtctatgtcttttacatataccacgtagtatgttgcagaatgttatcaaatgggtctttgtgcctatataaatatatacaactttcagcaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgcttcttggtattccgaggagcatgcctgtttgagtgtcattaaattctcaatccccttccagcttttagcttggttggtggcttggttggtgggggtatctgcaggcccttcataggtcagctcccctaaaatgtattagcggaaccgtttgcggtctgtcactggtgtgataattatctacatcacagggctgcttactgattgttcagcttctaatagtcccctctgttggacaattcttgaaacacttgacctcaaatcaggtaggattacccg
**KP348285LepiotaLepiota (Lepiota sp. PS-2015)Thailand              -----------------------ttgaaaagcaatagtgggttgtagctggctccttggagcatgtgcacgcctgctgtcttaatccatccacctgtgcatcatttgtagtcctgtgggtagtgtggctgaatcctcattgttgggtttggtctgattctctcaggtctatgtcttttacatataccacgtagtatgttgcagaatgttatcaaatgggtctttgtgcctatataaatatatacaactttcagcaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgcttcttggtattccgaggagcatgcctgtttgagtgtcattaaattctcaatccccttccagcttttagcttggttggtggcttggttggtgggggtatctgcaggcccttcataggtcagctcccctaaaatgtattagcggaaccgtttgcggtctgtcactggtgtgataattatctacatcacagggctgcttactgattgttcagcttctaatagtcccctctgttggacaattcttgaaaca-----------------------------
**KP348284LepiotaLepiota (Lepiota sp. PS-2015)Thailand              --gaacctgcggaaggatcattattgaaaagcaatagtgggttgtagctggctccttggagcatgtgcacgcctgctgtcttaatccatccacctgtgcatcatttgtagtcctgtgggtagtgtggctgaatcctcattgttgggtttggtctgattctctcaggtctatgtcttttacatataccacgtagtatgttgcagaatgttatcaaatgggtctttgtgcctatataaatatatacaactttcagcaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgcttcttggtattccgaggagcatgcctgtttgagtgtcattaaattctcaatccccttccagcttttagcttggttggtggcttggttggtgggggtatctgcaggcccttcataggtcagctcccctaaaatgtattagcggaaccgtttgcggtctgtcactggtgtgataattatctacatcacagggctgcttactgattgttcagcttctaatagtcccctctgttggacaattctgaaa-cact---------------------------
** - sequence was added after initial calculation of SH-s; (x) - there are x duplicates for this sequence; - click to see the extended view of this SH (all sequences listed)