UNITE logo

Communication and identification of DNA based fungal species
TH003938: Amanita Pers. | SH496667.07FU | DOI: 10.15156/BIO/SH496667.07FU | New version of this SH is available: SH1239038.08FU

Distance to the closest SH: 3.0
No. of sequences in SH: 1

Placement in the fungal classification
Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Agaricales; Amanitaceae
Index Fungorum: urn:lsid:indexfungorum.org:names:17045

Representative sequence: AB854648
Chosen by: automatically by the program
Date: 2013-11-19

Newer version(s) of this SH is/are available
SH code (Count*/Total count**)
SH1239038.08FU (1/1);
*Number of sequences carried over from pervious version
**Total number of sequences composing this SH in current version
Older version(s) of this SH is/are available
SH code (Count*/Total count**)
There are no older versions available for this SH.
*Number of sequences carried over from previous version
**Total number of sequences composing this SH in current version
Distribution map
*Locations without exact coordinates are displayed as spherical country centroids
                                                           |50                                                      |100                                                      |150                                                      |200                                                      |250                                                      |300                                                      |350                                                      |400                                                      |450                                                      |500
Accession numberUNITE taxon nameINSD taxon nameSequence sourceInteracting taxaSampling area<.  Alignment  
**AB854648AmanitaAmanitaceae (uncultured Amanita)Thailand              tcgaatgaagc-tcgtggctggaagttgttcgctggccctcttgtgggtaatgtgcacgcatctggtcatttgtttcttattttccacctgtgcactgactgtaggcacatttatcaatgtgtctatgacatatttaaa-tatacaccttttatatgtatgttttgtggtgaataaaataacattt---ttacaactttcaacaacggatctcttggctctcgcatcgatgaagaacacagcgaaatgtgataagtaatgtgaattgcagaatccagtgaatcatcgaatctttgaacgcatcttgcgctccttggtattccgaggagtatgcctgtttgagtgtcattaaactatcaaaatgtgacagtttgttgcgttttggactttgggagtatgctggaggtaatctagctctcctcaaaagcattcattagctttggggtacatcagtgtgataagttaatttatactggcattgtatctctctgcttctagaatattttacaatttt-attgt
** - sequence was added after initial calculation of SH-s; (x) - there are x duplicates for this sequence; - click to see the extended view of this SH (all sequences listed)