UNITE logo

Unified system for the DNA based fungal species linked to the classification Ver. 7.2
News, Courses & Workshops, Primer Notes

May 4, 2017: Call for Citizen Scientists "Submit specimens for sequencing!"

February 5, 2016: We have set up UNITE Community Twitter account for news and updates. Follow us, and you are up-to-date with UNITE news.

October 13, 2015: New UNITE homepage released.

March 2, 2015: Unified system for the DNA based fungal species (ver. 7.0) released.

October 14, 2013: UNITE homepage updated: Unified system for the DNA based fungal species (ver. 5.0) released.

March-August 2013: New papers relevant to the UNITE effort: Kõljalg et al. 2013, Lindahl et al. 2013, Bentsson-Palme et al. 2013, Lindner et al. 2013, Bates et al. 2013, and Hyde et al. 2013.

September 2012: DNA sequences need quality time too - guidelines for quality control published
Nilsson RH, Tedersoo L, Abarenkov K, Ryberg M, Kristiansson E, Hartmann M, Schoch CL, Nylander JAA, Bergsten J, Porter TM, Jumpponen A, Vaishampayan P, Ovaskainen O, Hallenberg N, Bengtsson-Palme J, Eriksson KM, Larsson K-H, Larsson E, Kõljalg U (2012) Five simple guidelines for establishing basic authenticity and reliability of newly generated fungal ITS sequences. MycoKeys 4: 37-62. doi: 10.3897/mycokeys.4.3606

Summer 2010: The proportion of reverse complementary ITS sequences in INSD is growing rapidly, with potentially detrimental effects for the unaware user. We have developed a software solution which we aim to have up and running in UNITE by the end of August 2010.

As per April 2010, PlutoF gives the user the opportunity to extract (locate) ITS1 and ITS2 from (in) fungal ITS sequences. A version for the ribosomal small sub-unit (SSU/16S/18S) is on the way.

As per March 2010, PlutoF now offers generic support for chimera tests of full-length fungal ITS sequences.

In February 2010 the new 454 pipeline for analysis of fungal ITS sequences was added to UNITE.

As per March 2009, support for UNITE ITS sequences from environmental samples (such as soil, ectomycorrhizal roots, orchids etc.) is enabled. You can include sequences with good metadata (like host, locality, habitat, and soil parameters) in your BLAST and galaxieBLAST runs by clicking the 'Envir.' box next to the 'Submit' button. Current number of fungal ITS sequences from environmental samples in UNITE: 7123

As per May 2006, support for INSD (GenBank, EMBL, DDBJ) ITS sequences is enabled. This means that you, in a single BLAST run, can compare your sequences with those in UNITE and INSD. (This pertains to galaxieBLAST as well.) All you have to do is to click the 'INSD' box next to the 'Submit' button; of course, not clicking this button is tantamount to running against UNITE data only. We use emerencia technology (PDF) for the INSD support; all properly annotated INSD fungal ITS sequences should thus be indexed and kept regularly updated (twice a week).

As of November 2005, galaxieBLAST and galaxieHMM support sequences that unintentionally were pasted reverse complementary (?revcomp?). They do this by pattern matching to the first 30 bp of the 5.8S region - unless a sequence features the pattern, the pattern will be looked for in the revcomp of the sequence. If the revcomp of the sequence features this pattern, the analyses will proceed with the revcomp of the sequence. If not, the analyses will proceed with the initial sequence (regardless of the fact that it did not feature the pattern). Thus, partial sequences lacking, say, ITS1 and 5.8S, should also be admissable. We do not anticipate any major complications with this approach - but please inform us of any problems you encounter. However, as explained elsewhere, the galaxie tools are tailored to work on full-length (as opposed to partial) ITS sequences, and you really should use the regular BLAST function of UNITE if you have only a portion of the ITS region available.


May 29 - June 1st, 2017: PhD students course - Metabarcoding Data Management and Open Data (Tartu, Estonia).

April 10-11, 2017: BE Workshop II - Taxonomic annotation of public fungal ITS sequences from the built environment (Aberdeen, UK).

May 23-24, 2016: BE Workshop I - Annotating public fungal ITS sequences from built environment according to the MIxS-Built Environment standard (Gothenburg, Sweden).

September 13-17, 2016: Course "Mycokey - digital key for fungi". Famous Danish mycologist Thomas Læssøe gave a one week course on MycoKey in Tartu, Estonia.

November 2-5, 2016: PhD students course - Biodiversity data management and Open Data (Tartu, Estonia).

January 28-30, 2013: UNITE jamboree - The fungal ITS sequence annotation workshop (Tartu, Estonia).

May 24-26, 2010: PhD students course - Web-based management and analysis of the biodiversity data (Tartu, Estonia).

Identifying ectomycorrhizal fungi - from environmental samples to DNA sequences. A NordForsk research training course 12-24 August 2007. http://www.bi.ku.dk/microbiology/ectofungi/

Primers for amplifying and sequencing fungal rDNA ITS region

PCR primers

To identify ectomycorrhizal (ECM) fungi, ITS1-ITS4, ITS1F-ITS4, and ITS1F-ITS4B are the most widely used primer pairs for PCR. However, using default annealing temperature of 55 degrees centigrade, we have met several difficulties using all of the primer pairs mentioned above.

  • ITS1-ITS4 is a pair of universal primers that co-amplifies angiosperm DNA. In case the DNA is extracted from sporocarps, pure cultures, or ECM of conifers, this primer pair amplifies the highest amount of target (ca 600 bp). To our knowledge, ITS1-ITS4 can amplify DNA from nearly all (ECM) fungi.
  • ITS1F-ITS4. ITS1F is a fungal specific primer. However, together with ITS4, ITS1F can result in weak amplification of highly concentrated pure angiosperm DNA. We have not observed plant bands on gel (slower) if DNA is extracted from ECM. A problem with ITS1F-ITS4 is gel smearing, that is production of numerous hardly separable bands. Raising annealing temperature a few degrees might resolve this problem. ITS1F tends to result in less target DNA compared to ITS1, but it has proved efficient in amplifying all ECM fungi.
  • ITS1F-ITS4B is a pair of strongly basidiomycete-specific primers. In addition to asco-mycetous ECM fungi, Sebacinaceae, Atheliaceae, and some Cortinariaceae species cannot be amplified. We strongly disencourage usage of ITS1F-ITS4B for ECM community studies.

ITS1 or ITS1F together with LR21 appear the most promising primer combination that does not co-amplify plant DNA. These primer pairs amplify nearly all ECM fungi, typically resulting in some 850-900 bp PCR products.

Primer_map_2015_March.png

Sequencing primers

In sequencing we have usually applied primers ITS1, ITS2, ITS3, ITS4. ITS2 and ITS3 usually give the best chromatograms. In case of amplification using primer pair ITS1(F)-LR21, ITS3 gives ca 550 bp sequence, covering both ITS2 and ca 200 bp of 28S rDNA. The latter offers more taxonomic opportunities in cases where ITS2 is not matched by other taxa. Sequencing the whole 850 bp with primers ITS1 and LR21 appears to be one of the best solutions.

Primer name Position
in gene
Sequence Gene/locus Direction Target Remarks Reference
Universal, fungal primers rDNA
5.8S_FungiCAAGAGATCCGTTGTTGAAAGTTITSrevFungifor paleo-DNAEpp et al. 2012
58A1F40GCATCGATGAAGAACGCITSfwdUniversalupgrade of ITS3, excludes GlomeromycotaMartin & Rygiewicz 2005
CTB639GCATATCAATAAGCGGAGGLSUfwdFungifor sequencing LR0R productsGarbelotto et al. 1997
ITS130TCCGTAGGTGAACCTGCGGITSfwdFungiexcludes SordariomycetesWhite et al. 1990
ITS1F90CTTGGTCATTTAGAGGAAGTAAITSfwdFungiexcludes basal fungi and TulasnellaGardes & Bruns 1993
ITS1Fngs90GGTCATTTAGAGGAAGTAAITSfwdFungiexcludes basal fungi and TulasnellaTedersoo et al. 2015a,b
ITS1ngs30TCCGTAGGTGAACCTGCITSfwdFungiexcludes SordariomycetesTedersoo et al. 2015a,b
ITS240GCTGCGTTCTTCATCGATGCITSfwdUniversalexcludes some Agaricales, TremellalesWhite et al. 1990
ITS340GCATCGATGAAGAACGCAGCITSfwdUniversalexcludes CantharellalesWhite et al. 1990
ITS3mix1-540CANCGATGAAGAACGYRGITSfwdUniversalexcludes TulasnellaceaeTedersoo et al. 2014
ITS440TCCTCCGCTTATTGATATGCITSrevUniversalhas central mismatches to some groups and Metazoa and ArchaeorhizomycetesWhite et al. 1990
ITS4ngs40TCCTSCGCTTATTGATATGCITSrevUniversalhas central mismatches to some groups and Metazoa and ArchaeorhizomycetesWhite et al. 1990
ITS550GGAAGTAAAAGTCGTAACAAGGITSfwdUniversalbest sequencing primer for ITSOf/1F productsWhite et al. 1990
fITS770GTGARTCATCGAATCTTTGITSfwdFungiexcludes ca 2% minor groupsIhrmark et al. 2012
fITS7R70CAAAGATTCGATGAYTCACITSrevFungiexcludes ca 2% minor groupsL. Tedersoo, unpublished
gITS770GTGARTCATCGARTCTTTGITSfwdFungiexcludes ca 2% minor groupsIhrmark et al. 2012
ITS86F70GTGAATCATCGAATCTTTGAAITSfwdFungi, Plantsexcludes ca 2% minor groups and TulasnellaceaeTurenne et al. 1998
fITS955GAACACAGCGAAATGTGAITSfwdFungiexcludes ca 4% minor groupsIhrmark et al. 2012
ITS9mun190TGTACACACCGCCCGTCGITSfwdFungi, Plantslittle usedEgger 1995
ITSOF90ACTTGGTCATTTAGAGGAAGTITSfwdFungioutperforms ITS1FTedersoo et al. 2008
LF340336TACTTGTKCGCTATCGGITSrevUniversalfor sequencing LB-W productsTedersoo et al. 2008
LF402402TTCCCTTTYARCAATTTCACITS/LSUrevFungiexcludes chytrids, Basidio-yeasts,etc.Tedersoo et al. 2015a,b
LF402F402GTGAAATTGYTRAAAGGGAALSUfwdFungiexcludes chytrids, Basidio-yeasts,etc.Tedersoo et al. 2015a,b
LR0B15GGTAGTCCTACCTGATTTGITSrevBasidiomycotaexcludes several groups incl SebacinalesL. Tedersoo, unpublished
LR0R24ACCCGCTGAACTTAAGCLSUfwdUniversalwidely used for LSUHopple & Vilgalys 1994
LR21370ACTTCAAGCGTTTCCCTTTITS/LSUrevFungiexcludes many Asco- and BasidiomycotaHopple & Vilgalys 1994
LR3670CCGTGTTTCAAGACGGGITS/LSUrevUniversalwidely used for LSUHopple & Vilgalys 1994
LR3R670GTCTTGAAACACGGACCLSUfwdUniversalwidely used for LSUHopple & Vilgalys 1994
LR5990TCCTGAGGGAAACTTCGLSUrevUniversalwidely used for LSUHopple & Vilgalys 1994
LR5-Fung900CGATCGATTTGCACGTCAGALSUrevFungiexcludes plants, alveolates and rhizarians, but not stramenopiles or animalsTedersoo et al. 2008
LR61165CGCCAGTTCTGCTTACCLSUrevUniversalfair performanceHopple & Vilgalys 1994
LR71475TACTACCACCAAGATCTLSUrevUniversalwidely used for LSUHopple & Vilgalys 1994
nLSU1221r1210CTAGATGAACYAACACCTTLSUrevFunginot enough testedSchadt et al. 2003
NS7a1430CAATAACAGGTCTGTGATGCSSU/ITSfwdUniversalwidely usedWhite et al. 1990 (modified)
TW13635GGTCCGTGTTTCAAGACGITS/LSUrevUniversalanalogue of LR3T.J. White, unpublished
TW14950GCTATCCTGAGGGAAACTTCLSUrevUniversalanalogue of LR5T.J. White, unpublished
Fungal clade-specific primers rDNA
ITS3Seb150TGAGTGTCATTGTAATCTCACITSfwdSebacinalesexcludes ca 20% of target SebacinalesM.Berbee, unpublished
ITS4B200CAGGAGACTTGTACACGGTCCAGITSrevBasidiomycotaexcludes ca 40% of target taxaGardes & Bruns 1993
ITS4B1200CAAGRGACTTRTACACGGTCCAITSrevBasidiomycotaupdate of ITS4B, still excludes 20% of taxaTedersoo et al. 2007
ITS4-Cg100CACATGGCAARGGCAACCGITSrevCenococcumfor improved sequence qualityBahram et al. 2011
ITS4-Clav20GGTAGTCCCACCTGATTCITSrevClavulina, Cantharellus p.p.for improved sequence qualityTedersoo et al. 2011
ITS4-GloeT200CACAGAAAGCACTTCTCTAAITSrevGloeotulasnellafor improved sequence qualityL. Tedersoo, unpublished
ITS4-Russ20AGCGGGTAGTCTCACCCITSrevRussulaceaefor improved sequence qualityTedersoo et al. 2011
ITS4-Seb20TCAGCGGGTARTCCTACTCITSrevSebacina clade Afor improved sequence qualityTedersoo et al. 2011
ITS4-Sord100CCCGTTCCAGGGAACTCITSrevSordariomycetesfor improved sequence qualityTedersoo et al. 2009
ITS4-Tom150AACTCGGACGACCAGAGGCAITSrevTomentella, Thelephoraexcludes 5-10% of ThelephoraceaeTedersoo et al. 2011
ITS4-Tuber230CTCGACTCGTAGAAGRCACTITSrevTuberaceaenot enough testedBonito et al. 2013
ITS4-Tul120CCGCCAGATTCACACATTGAITSrevTulasnellaceaeexcludes ca 30% of Tulasnellaceae!Taylor & McCormick, 2008
ITS4-Tul250TTCTTTTCCTCCGCTGAWTAITSrevTulasnella (divergent)complements to ITS4 and ITS4-Tul for divergent TulasnellasOja et al. 2015
LA-W360CTTTTCATCTTTCGATCACTCITSrevAscomycotaexcludes some yeasts, fair PCR productTedersoo et al. 2008
LB-W360CTTTTCATCTTTCCCTCACGGITSrevBasidiomycota, Zygomycota, Plantaeexcludes smuts, some CantharellusTedersoo et al. 2008
LB-wR350GCGAACAAGTACCGTGAGGLSUfwdBasidiomycota, Zygomycota, Plantaeexcludes smuts, some CantharellusL. Tedersoo, unpublished
LB-y870TTTGCACGTCAGAATCGCTALSUrevBasidiomycota (excludes Plantae, other fungi)good for root tip LSU (excludes some Tulasnella)Tedersoo et al. 2008
LB-z1120AAAAATGGCCCACTAGAAACTLSUrevBasidiomycotagood for root tip LSU, excludes some CantharellusTedersoo et al. 2008
LB-Z-Sord1020GTTTGAGAATGGATGAAGGCLSUrevSordariomycetesnot enough testedTedersoo et al. 2009
LR0R-Tul240CGTTGATTTAAGCATATTAWTCLSUfwdTulasnella (divergent)reverse of ITS4-Tul2; not enough testedL. Tedersoo, unpublished
LR21-Ath280CCAAACAACTCGACTCTTCITSrevAthelialesnot enough testedL. Tedersoo, unpublished
LR21-Cenoc 460GATGAGCAACATCAGGCAGITSrevCenococcumnot enough testedL. Tedersoo, unpublished
LR21-Cer300CGACTCGTTGAGAGCACAAITSrevCeratobasidiaceaenot enough testedTedersoo et al. 2011
LR3-Aln630CCTSAGCACGAACGTGGTAITS/LSUrevAlnicola, Hebeloma, Entoloma, Inocybe p. partefor improved sequence qualityL. Tedersoo, unpublished
LR3-Asc 680CACYTACTCAAATCCWAGCGLSUrevAscomycotanot enough testedTedersoo et al. 2009
LR3-Cenoc580TTCAGGCTGGCCGCATTTCITS/LSUrevCenococcumnot enough testedL. Tedersoo, unpublished
LR3End650AYCATTAMGTCAGCGACCTALSUrevEndogonalesnot enough testedL. Tedersoo, unpublished
LR3-Pez930CMTCRGGATCGGTCGATGGITS/LSUrevPezizalesexcludes 20% of PezizalesTedersoo et al. 2011
LR3-Tul570GACTCGCATGCAAGGTRCAITS/LSUrevTulasnellaceaeexcludes 20% of TulasnellaceaeL. Tedersoo, unpublished
LR5-Cer860CTCTGGCTTCACCCTATGITS/LSUrevCeratobasidiaceaenot enough testedL. Tedersoo, unpublished
LR5-Fung880CGATCGATTTGCACGTCAGALSUrevFungi, Metazoa (excl. Plantae)good for plant tissuesTedersoo et al. 2008
LR5-Seb1000ATTCGCTTTACCGCACAAGGLSUrevSebacinalesnot enough testedTedersoo et al. 2008
LR5-Tom740CTACCGTAGAACCGTCTCCITS/LSUrevTomentella, Thelephoraexcludes 10% of ThelephoraceaeTedersoo et al. 2008
LR6 Leot-Sord1100AAAATGGCCCACTAGTGTTGLSUrevLeotiomycetes, SordarioMnot enough testedTedersoo et al. 2011
LR6-Asc1100AAAATGGCCCACTAGTAACGLSUrevAscomycota, v.a. Leot,SordMnot enough testedTedersoo et al. 2011
LR6-Pez1100CCTCATAAAACRAKATCGTTACLSUrevPezizalesnot enough testedL. Tedersoo, unpublished
LSUmAr930[composite]ITS/LSUrevGlomeromycotagood for AMFKrüger et al. 2009
LSUmBr840[composite]ITS/LSUrevGlomeromycotagood for AMFKrüger et al. 2009
NL6Amun420CAAGTGCTTCCCTTTCAACAITSrevAscomycotanot specific, excludes many groups; 1-2 mismatches to ArchaeorhizomycetesEgger 1995
NL6Bmun420CAAGCGTTTCCCTTTCAACAITSrevBasidiomycotanot specific, excludes many groups
SSUmAf300[composite]ITSfwdGlomeromycotagood for AMFKrüger et al. 2009
SSUmCf250[composite]ITSfwdGlomeromycotagood for AMFKrüger et al. 2009
Universal, fungal SSU
FF1100580CCAGCTCCAATAGCGTATATTASSUfwdFungiVainio & Hantola 2000
FF700980GATACCGTIGTAGTCTSSUfwdFungiVainio & Hantola 2000
FF3901290CGATAACGAACGAGACCTSSUfwdFungiVainio & Hantola 2000
FR11680AICCATTCAATCGGTAITSSUrevFungiVainio & Hantola 2000
SSU515f500GTGCCAGCMGCCGCGGTAASSUfwdEuakryote/ProkaryoteCross-domain primerTurner et al. 1999
SSU515Fngs500GCCAGCAACCGCGGTAASSUfwdEuakryote/ProkaryoteTedersoo et al. 2015a,b
SSU0817f790TTAGCATGGAATAATRRAATAGGASSUfwdEukaryoteBorneman & Hartin 2000
SSU1196R1170TCTGGACCTGGTGAGTTTCCSSUrevEukaryoteBorneman & Hartin 2000
SSU1196Rngs1170TCTGGACCTGGTGAGTTTSSUrevEukaryoteTedersoo et al. 2015a,b
SSU1391R1360GACGGGCGGTGWGTRCASSUrevEukaryoteTurner et al. 1999
SSU1536R1490ATTGCAATGCYCTATCCCCASSUrevEukaryoteBorneman & Hartin 2000
EF4120GGAAGGGRTGTATTTATTAGSSUfwdEukaryoteSmit et al. 1999
EF31700TCCTCTAAATGACCAAGTTTGSSUrevEukaryoteSmit et al. 1999
Fung5680GTAAAAGTCCTGGTTCCCCSSUrevFungiexcludes 10% groups incl. ArchaeorhizoMSmit et al. 1999
AM11150GTTTCCCGTAAGGCGCCGAASSUrevGlomeromycotaexcludes early diverging groupsHelgason et al. 1998
AML1230ATCAACTTTCGATGGTAGGATAGASSUrevGlomeromycotaLee et al. 2008
AML21170GAACCCAAACACTTTGGTTTCCSSUrevGlomeromycotaLee et al. 2008
NS130GTAGTCATATGCTTGTCTCSSUfwdEukaryoteWhite et al. 1990
NS2560GGCTGCTGGCACCAGACTTGCSSUrevEukaryoteWhite et al. 1990
NS71400GAGGCAATAACAGGTCTGTGATGCSSUfwdEukaryoteWhite et al. 1990
NS61400GCATCACAGACCTGTTATTGCCTCSSUrevEukaryoteWhite et al. 1990
NS3560GCAAGTCTGGTGCCAGCAGCCSSUfwdEukaryoteWhite et al. 1990
NS41120CTTCCGTCAATTCCTTTAAGSSUrevEukaryoteWhite et al. 1990
NS51140AACTTAAAGGAATTGACGGAAGSSUfwdEukaryoteWhite et al. 1990
NS81770TCCGCAGGTTCACCTACGGASSUrevEukaryoteWhite et al. 1990
NS20860CGTCCCTATTAATCATTACGSSUrevEukaryoteWhite et al. 1990
NS241760AAACCTTGTTACGACTTTTASSUrevEukaryoteWhite et al. 1990
NS31535TTGGAGGGCAAGTCTGGTGCCSSUfwdFungiwidely usedSimon et al. 1992
Euk742R890AAATCCAAGAATTTCACCTCTSSUrevEukaryotepoor performanceTedersoo et al. 2015a,b
Plant ITS primers
RydinF70GAACCTTATCRTTTAGAGGAAGGITSfwdPlantae
Rydin R50CCGCCAGATTTTCACGCTGGGCITSrevPlantae
ITS4Ang20GTARTCCCGCCTGACCTGITSrevAngiospermae
ITS4PL260TTCCCAAACAACCCGACTCGITSrevPlantaematches many fungi
ITS-OP70ttaTCATTTAGAGGAAGgAgITSfwdPlantaeplant analogue of ITS1F
PN16400TCCCTTTCAACAATTTCACGITS/LSUrevPlantaeexcludes many groups
18S-IGS20ACTACTGGCAGGATCAACCAGIGSrevPlantae, Fungi
Primers for chloroplast markers
trnL-c.CGAAATCGGTAGACGCTACGtrnLfwdPlantae
trnL-d.GGGGATAGAGGGACTTGAACtrnLrevPlantae
trn F.ATTTGAACTGGTGACACGAGtrnLrevPlantae
trn E.GGTTCAAGTCCCTCTATCCCtrnLfwdPlantae
trn H.CGCGCATGGTGGATTCACAATCCtrnLfwdPlantae
psbA.GTTATGCATGAACGTAATGCTCtrnLrevPlantae
atpF.GAAGTAGTAGGATTGATTCTCrbcLrevPlantae
rbcL.CCCTACAACTCATGAATTAAGrbcLfwdPlantae
Oomycete primers
ITS1Oo0GGAAGGATCATTACCACACITSfwdOomycota (99%)L. Tedersoo, unpublished
ITS2Oo40GCAGCGKTCTTCATCGRTGTITSfwdOomycota (99%)L. Tedersoo, unpublished
ITS3Oo150AGTATGYYTGTATCAGTGTCITSfwdOomycota (99%)T. Riit, unpublished
ITS3Perofascia140CCACCTATGCTACGCTATGITSfwdT. Riit, unpublished

References

  • Bahram M, Põlme S, Kõljalg U, Tedersoo L. 2011. A single European aspen (Populus tremula) tree individual may potentially harbour dozens of Cenococcum geophilum ITS genotypes and hundreds of species of ectomycorrhizal fungi. FEMS Microbiol. Ecol. 75: 313–320.
  • Bonito G, Smith ME, Nowak M, Healy RA, Guevara G, Cazares E et al. 2013. Historical biogeography and diversification of truffles in the Tuberaceae and their newly identified Southern Hemisphere sister lineage. PLoS ONE 8: e52765.
  • Borneman J, Hartin RJ. 2000. PCR primers that amplify fungal rRNA genes from environmental samples. Appl. Environ, Microbiol. 66: 4356–4360.
  • Egger KN. 1995. Molecular analysis of ectomycorrhizal fungal communities. Can. J. Bot. 73: S1415-S1422.
  • Epp LS, Boessenkool S, Bellemain EP, Haile J, Esposito A, Riaz T, Ers EUs C, Gusarov VI, Edwards ME, Johnsen A, Stenøien H, Hassel K, Kauserud H, Yoccoz N, Brathen KA, Willerslev E, Taberlet P, Coissac E, Brochmann C, 2012. New environmental metabarcodes for analysing soil DNA: potential for studying past and present ecosystems. Molecular Ecology 21: 1821-1833.
  • Garbelotto MM, Lee HK, Slaughter G, Popenuck T, Cobb FW, Bruns TD. 1997. Heterokaryosis Is not required for virulence of Heterobasidion annosum. Mycologia 89: 92-102.
  • Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes – application to the identification of mycorrhizas and rusts. Mol. Ecol. 2: 113-118.
  • Gonzales P, Labarere J. 1998. Sequence and secondary structure of the mitochondrial Small-Subunit rRNA V4, V6, and V9 domains reveal highly species-specific variations within the genus Agrocybe. Appl. Enviro. Microbiol. 64: 4149–4160.
  • Helgason T, Daniell TJ, Husband R, Fitter AH, Young JPW. 1998. Ploughing up the wood-wide web? Nature 394: 431.
  • Hopple JS, Vilgalys R. 1994. Phylogenetic relationships among coprinoid txa and allies based on data from restriction site mapping of nuclear rDNA. Mycologia 86: 96-107.
  • Ihrmark K, Bödeker ITM, Cruz-Martinez K, Friberg H, Kubartova A, Schenk J, Strid Y, Stenlid J, Brandström-Durling M, Clemmensen KE, Lindahl BD. 2012. New primers to amplify the fungal ITS2 region - evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiol. Ecol. , in press.
  • Krüger M, Stockinger H, Krüger C, Schüssler A. 2009. DNA-based species level detection of Glomeromycota: one PCR primer set for all arbuscular mycorrhizal fungi. New Phytol. 183: 212-223.
  • Lee J, Lee S, Young PW, 2008. Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi. FEMS Microbiol. Ecol. 65: 339-349.
  • Martin KJ, Rygiewicz PT. 2005. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts. BMC Microbiol. 5: 28.
  • Oja J, Bahram M, Tedersoo L, Kull T, Kõljalg U. 2015. Temporal patterns of orchid mycorrhizal fungi in meadows and forests as revealed by 454 pyrosequencing. New Phytol. 205: 1608–1618.
  • Rehner SA, Buckley E. 2005. A Beauveria phylogeny inferred from nuclear ITS and EF1-a sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 97: 84-98.
  • Schadt CW, Martin AP, Lipson DA, Schmidt SK. 2003. Seasonal dynamics of previously unknown fungal lineages in tundra soils. Science 301: 1359-1361.
  • Simon L, Lalonde M, Bruns TD. 1992. Specific amplification of 18S fungal ribosomal genes from vesicular–arbuscular endomycorrhizal fungi colonising roots. Appl. Environ. Microbiol. 58: 291–295.
  • Smit E, Leeflang P, Glandorf B, van Elsas JD, Wernars K. 1999 Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes encoding 18S rRNA and temperature gradient gel electrophoresis. Appl. Environ. Microbiol. 65: 2614–2621.
  • Taylor DL, McCormick MK. 2008. Internal transcribed spacer primers and sequences for improved characterization of basidomycetous orchid mycorrhizas. New Phytol. 177: 1020-1033.
  • Tedersoo L, Anslan S, Bahram M, Põlme S, Riit T, Kõljalg U, Kisand V, Nilsson RH, Liiv I, Hillebrand F, Abarenkov K. 2015a. Performance of nine primer pair and genetic marker combinations in high-throughput sequencing of fungi. MycoKeys (pending review)
  • Tedersoo L, Anslan S, Bahram M, Põlme S, Riit T, Kõljalg U, Nilsson RH, Hillebrand F, Abarenkov K. 2015a. Performance of nine primer pair and genetic marker combinations in high-throughput sequencing of fungi. Science (pending review)
  • Tedersoo L, Bahram M, Jairus T, Bechem E, Chinoya S, Mpumba R, Leal M, Randrianjohany E, Razafimandimbison S, Sadam A, Naadel T, Kõljalg U. 2011. Spatial structure and the effects of host and soil environments on communities of ectomycorrhizal fungi in wooded savannas and rain forests of Continental Africa and Madagascar. Mol. Ecol. 20: 3071-3080.
  • Tedersoo L, Jairus T, Horton BM, Abarenkov K, Suvi T, Saar I, Kõljalg U. 2008. Strong host preference of ectomycorrhizal fungi in a Tasmanian wet sclerophyll forest as revealed by DNA barcoding and taxon-specific primers. New Phytol. 180: 479-490.
  • Tedersoo L, Pärtel K, Jairus T, Gates G, Põldmaa K, Tamm H. 2009. Ascomycetes associated with ectomycorrhizas: molecular diversity and ecology with particular reference to the Helotiales. Environ. Microbiol. 11: 3166–3178.
  • Tedersoo L, Suvi T, Beaver K, Kõljalg U. 2007. Ectomycorrhizal fungi of the Seychelles: diversity patterns and host shifts from the native Vateriopsis seychellarum (Dipterocarpaceae) and Intsia bijuga (Caesalpiniaceae) to the introduced Eucalyptus robusta (Myrtaceae), but not Pinus caribea (Pinaceae). New Phytol. 175: 321-333.
  • Turner S, Pryer KM, Miao VPW, Palmer JD. 1999. Investigating deep phylogenetic relationships among cyanobacteria and plastids by small subunit rRNA sequence analysis. J. Euk. Microbiol. 46: 327–338.
  • Vainio EJ, Hantula J. 2000. Direct analysis of wood-inhabiting fungi using denaturing gel electrophoresis of amplified ribosomal DNA. Mycol. Res. 104: 927-936.
  • White TJ, Bruns TD, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH. (eds). PCR Protocols: A Guide to Methods and Applications. Academic Press: London, pp. 315 – 322.

Alternative online sources

Compiled by Leho Tedersoo