UNITE logo
a non-profit association

rDNA ITS based identification of Eukaryotes and their communication via DOIs
UNITE Resources
Downloads
  • Reference/representative sequences

    Following Kõljalg et al. (2013), each terminal fungal taxon for which two or more ITS sequences are available is referred to as a species hypothesis (SH). One sequence is chosen to represent each SH; these sequences are called representative sequences (RepS) when chosen automatically by the computer and reference sequences (RefS) when those choices are overridden (or confirmed) by users with expert knowledge of the taxon at hand.

    There are five releases of the RepS/RefS set: special files pre-formatted for QIIME, mothur, USEARCH, and CREST use, and one general FASTA release for, e.g., local BLAST searches. Pre-formatted datasets can also be used for other pipelines supporting these formats, e.g. SCATA and LotuS.

    There is a brand new release of UNITE/INSDC representative/reference sequences for use in reference-based chimera detection of fungal ITS sequences in UCHIME and similar programs.

  • QIIME release

    QIIME release (download)
    Three sets of QIIME files are released, corresponding to the SHs resulting from clustering at the 3% distance (97% similarity) and 1% distance (99% similarity) threshold levels. The third set of files is the result of a dynamic use of clustering thresholds, such that some SHs are delimited at the 3% distance level, some at the 2.5% distance level, some at the 2% distance level, and so on; these choices were made manually by experts of those particular lineages of fungi. The syntax is the same throughout the three sets of files.

    Each SH is given a stable name of the accession number type, here shown in the FASTA file of the dynamic set:

    >SH1206915.10FU_FJ357315_refs
    CACAATATGAAGGCGGGCTGGCACTCCTTGAGAGGACCGGC…
    
    SH1206915.10FU = accession number of the SH with 10 indicating the major version of the UNITE SH
    FJ357315 = GenBank/UNITE accession number of sequence chosen to represent the SH
    refs = this is a manually designated RefS
    (reps = this is an automatically chosen RepS)
    

    In the corresponding text file, the classification string of the SH is found:

    SH1206915.10FU_FJ357315_refs    k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Pleosporales;f__Pleosporaceae;g__Alternaria;s__Alternaria_planifunda;sh__SH1206915.10FU

    This specifies the hierarchical classification of the sequence. k = kingdom; p = phylum ; c = class ; o = order ; f = family ; g = genus ; s = species; and sh = species hypotheses. Missing information is indicated as "unidentified" item; “f__unidentified;” means that no family name for the sequence exists.

    UNITE uses Catalogue of Life for overall eukaryotic taxonomy and classification. For Fungi, we follow the Outline of Fungi classification with some modifications.

    NB! UNITE v10.0 reference datasets, trained for use with Qiime2 2024.2, have been generously provided by Colin J. Brislawn at https://github.com/colinbrislawn/unite-train/releases.

    List of all QIIME releases
    Version no Release date Taxon group No of RefS* No of RepS* Release status Link Notes (changes to previous version)
    10.0 2025-02-19 Fungi 20 295 81 842 Current https://doi.org/10.15156/BIO/3301241 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): UNITE QIIME release for Fungi. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301241

    Includes singletons set as RefS (in dynamic files).
    10.0 2025-02-19 Fungi 20 295 147 735 Current https://doi.org/10.15156/BIO/3301242 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): UNITE QIIME release for Fungi 2. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301242

    Includes global and 3% distance singletons.
    10.0 2025-02-19 All eukaryotes 20 802 136 018 Current https://doi.org/10.15156/BIO/3301243 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): UNITE QIIME release for eukaryotes. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301243

    Includes singletons set as RefS (in dynamic files).
    10.0 2025-02-19 All eukaryotes 20 802 245 787 Current https://doi.org/10.15156/BIO/3301244 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): UNITE QIIME release for eukaryotes 2. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301244

    Includes global and 3% distance singletons.
    10.0 2024-04-04 Fungi 18 895 74 190 https://doi.org/10.15156/BIO/2959336 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): UNITE QIIME release for Fungi. Version 04.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959336

    Includes singletons set as RefS (in dynamic files).
    10.0 2024-04-04 Fungi 18 895 140 300 https://doi.org/10.15156/BIO/2959337 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): UNITE QIIME release for Fungi 2. Version 04.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959337

    Includes global and 3% distance singletons.
    10.0 2024-04-04 All eukaryotes 19 302 122 914 https://doi.org/10.15156/BIO/2959338 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): UNITE QIIME release for eukaryotes. Version 04.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959338

    Includes singletons set as RefS (in dynamic files).
    10.0 2024-04-04 All eukaryotes 19 302 232 937 https://doi.org/10.15156/BIO/2959339 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): UNITE QIIME release for eukaryotes 2. Version 04.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959339

    Includes global and 3% distance singletons.
    9.0 2023-07-18 Fungi 19 051 143 384 https://doi.org/10.15156/BIO/2938079 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): UNITE QIIME release for Fungi. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938079

    Includes singletons set as RefS (in dynamic files).
    9.0 2023-07-18 Fungi 19 051 187 443 https://doi.org/10.15156/BIO/2938080 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): UNITE QIIME release for Fungi 2. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938080

    Includes global and 3% distance singletons.
    9.0 2023-07-18 All eukaryotes 19 451 215 454 https://doi.org/10.15156/BIO/2938081 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): UNITE QIIME release for eukaryotes. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938081

    Includes singletons set as RefS (in dynamic files).
    9.0 2023-07-18 All eukaryotes 19 451 307 276 https://doi.org/10.15156/BIO/2938082 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): UNITE QIIME release for eukaryotes 2. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938082

    Includes global and 3% distance singletons.
    9.0 2022-10-16 Fungi 17 495 143 840 https://doi.org/10.15156/BIO/2483915 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE QIIME release for Fungi. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483915

    Includes singletons set as RefS (in dynamic files).
    9.0 2022-10-16 Fungi 17 495 188 070 https://doi.org/10.15156/BIO/2483916 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE QIIME release for Fungi 2. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483916

    Includes global and 3% distance singletons.
    9.0 2022-10-16 All eukaryotes 17 683 216 528 https://doi.org/10.15156/BIO/2483917 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE QIIME release for eukaryotes. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483917

    Includes singletons set as RefS (in dynamic files).
    9.0 2022-10-16 All eukaryotes 17 683 308 588 https://doi.org/10.15156/BIO/2483918 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE QIIME release for eukaryotes 2. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483918

    Includes global and 3% distance singletons.
    8.3 2021-05-10 Fungi 14 097 44 343 https://doi.org/10.15156/BIO/1264708 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): UNITE QIIME release for Fungi. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1264708

    Includes singletons set as RefS (in dynamic files).
    8.3 2021-05-10 Fungi 14 097 83 993 https://doi.org/10.15156/BIO/1264763 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): UNITE QIIME release for Fungi 2. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1264763

    Includes global and 97% singletons.
    8.3 2021-05-10 All eukaryotes 14 237 96 423 https://doi.org/10.15156/BIO/1264819 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): UNITE QIIME release for eukaryotes. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1264819

    Includes singletons set as RefS (in dynamic files).
    8.3 2021-05-10 All eukaryotes 14 237 190 888 https://doi.org/10.15156/BIO/1264861 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): UNITE QIIME release for eukaryotes 2. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1264861

    Includes global and 97% singletons.
    8.2 2020-02-20 Fungi 12 664 35 077 https://doi.org/10.15156/BIO/786385 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE QIIME release for Fungi. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786385

    Includes singletons set as RefS (in dynamic files).
    8.2 2020-02-20 Fungi 12 664 71 723 https://doi.org/10.15156/BIO/786387 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE QIIME release for Fungi 2. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786387

    Includes global and 97% singletons.
    8.2 2020-02-20 All eukaryotes 12 666 91 074 https://doi.org/10.15156/BIO/786386 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE QIIME release for eukaryotes. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786386

    Includes singletons set as RefS (in dynamic files).
    8.2 2020-02-20 All eukaryotes 12 666 183 678 https://doi.org/10.15156/BIO/786388 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE QIIME release for eukaryotes 2. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786388

    Includes global and 97% singletons.
    8.0 2018-11-18 Fungi 9 407 26 260 https://doi.org/10.15156/BIO/786334 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE QIIME release for Fungi. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786334

    Includes singletons set as RefS (in dynamic files).
    8.0 2018-11-18 Fungi 9 407 61 635 https://doi.org/10.15156/BIO/786349 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE QIIME release for Fungi 2. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786349

    Includes global and 97% singletons.
    8.0 2018-11-18 All eukaryotes 9 409 54 013 https://doi.org/10.15156/BIO/786335 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE QIIME release for eukaryotes. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786335

    Includes singletons set as RefS (in dynamic files).
    8.0 2018-11-18 All eukaryotes 9 409 112 778 https://doi.org/10.15156/BIO/786350 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE QIIME release for eukaryotes 2. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786350

    Includes global and 97% singletons.
    7.2 2017-12-01 8 997 21 699 https://doi.org/10.15156/BIO/587481 When using this resource, please cite it as follows:
    UNITE Community (2017): UNITE QIIME release. Version 01.12.2017. UNITE Community. https://doi.org/10.15156/BIO/587481

    Includes singletons set as RefS (in dynamic files).
    7.2 2017-12-01 8 997 49 052 https://doi.org/10.15156/BIO/587481 When using this resource, please cite it as follows:
    UNITE Community (2017): UNITE QIIME release. Version 01.12.2017. UNITE Community. https://doi.org/10.15156/BIO/587481

    Includes global and 97% singletons.
    7.2 2017-10-10 8 756 21 793 Download Includes singletons set as RefS (in dynamic files).
    7.2 2017-10-10 8 756 49 160 Download Includes global and 97% singletons.
    7.2 2017-06-28 8 747 21 809 Download Includes singletons set as RefS (in dynamic files).
    7.2 2017-06-28 8 747 49 407 Download Includes global and 97% singletons.
    7.1 2016-11-20 8 180 21 163 Download Includes singletons set as RefS (in dynamic files).
    7.1 2016-11-20 8 180 46 389 Download Includes global and 97% singletons.
    7.1 2016-08-22 6 285 19 698 Download Includes singletons set as RefS (in dynamic files).
    7.1 2016-08-22 6 285 47 408 Download Includes global and 97% singletons.
    7.0 2016-01-31 6 273 16 991 Download
    7.0 2016-01-31 6 273 37 020 Download
    7.0 2015-08-01 5 925 16 849 Download
    7.0 2015-08-01 5 925 36 878 Download
    7.0 2015-03-02 4 384 17 730 Download
    7.0 2015-03-02 4 384 37 921 Download
    6.0 2014-12-30 4 431 16 759 Download
    6.0 2014-12-30 4 431 41 231 Download
    6.0 2014-09-10 4 403 16 782 Download
    6.0 2014-09-10 4 403 41 271 Download
    6.0 2014-07-04 3 973 17 084 Download
    6.0 2014-07-04 3 973 41 596 Download
    6.0 2014-05-13 3 245 17 643 Download
    6.0 2014-05-13 3 245 42 454 Download
    6.0 2014-02-09 3 059 17 816 Download
    6.0 2014-02-09 3 059 43 072 Download
    6.0 2014-01-15 3 032 17 840 Download Includes singletons set as RefS (in dynamic files).
    6.0 2014-01-15 3 032 43 098 Download Includes global and 97% singletons.
    6.0 2013-12-19 2 452 18 138 Download Default clustering threshold for dynamic files is 98.5%. Comprises all SHs with two or more sequences.
    6.0 2013-12-19 2 452 43 492 Download As above, but also comprises all global and 97% singletons. Default clustering threshold for dynamic files is 98.5%
    6.0 2013-12-08 2 441 15 325 Download
    6.0 2013-12-08 2 441 40 679 Download Includes global and 97% singletons.
    5.0 2013-10-15 2 502 15 891 Download
    5.0 2013-08-27 2 334 15 986 Download FASTA file format:
    >SH099456.05FU_FJ357315_refs
    CACAATATGAAGGCGGGCTGGCACTCCTTGAGAGGACCGGC…

    Taxonomy file format:
    >SH099456.05FU_FJ357315_refs k__Fungi;
    p__Ascomycota; c__Dothideomycetes;
    o__Pleosporales; f__Pleosporaceae;
    g__Embellisia; s__Embellisia_planifunda

    Missing information is indicated as a nullified item; “f__;” means that no family name for the sequence exists.
    *Based on dynamic release
  • mothur release

    mothur release (download)
    Except for slight formatting differences, these files are the same as for the QIIME release. More information is provided in the mothur wiki (http://www.mothur.org/wiki/UNITE_ITS_database).

    NB! For a bug fix in the taxonomy file of the earlier (pre 2023) version please run the following commands inside your mothur UNITE release directory -

    mv UNITE_taxonomy.txt to_be_fixed.txt
    sed 's/$/;/' to_be_fixed.txt > UNITE_taxonomy.txt
    

    There are full "UNITE+INSD" datasets available in mothur format:
    • download1 (Fungi) - this dataset comprises of all quality filtered unclustered UNITE + INSD sequences for Fungi (2 069 189) included in the UNITE Species Hypotheses.
      Citation: Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): Full mothur UNITE+INSD dataset 1. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301237
    • download2 (Fungi) - this dataset comprises of all quality filtered unclustered UNITE + INSD sequences for Fungi (2 690 296).
      Citation: Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): Full mothur UNITE+INSD dataset 2. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301238
    • download3 (All eukaryotes) - this dataset comprises of all quality filtered unclustered UNITE + INSD sequences for eukaryotes (2 930 276) included in the UNITE Species Hypotheses.
      Citation: Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): Full mothur UNITE+INSD dataset 3. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301239
    • download4 (All eukaryotes) - this dataset comprises of all quality filtered unclustered UNITE + INSD sequences for eukaryotes (4 057 290).
      Citation: Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): Full mothur UNITE+INSD dataset 4. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301240
    List of all mothur releases
    Version no Release date Taxon group No of RefS* No of RepS* Release status Link Notes
    10.0 2025-02-19 Fungi 20 295 81 842 Current https://doi.org/10.15156/BIO/3301233 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): UNITE mothur release for Fungi. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301233

    Includes singletons set as RefS (in dynamic files).
    10.0 2025-02-19 Fungi 20 295 147 735 Current https://doi.org/10.15156/BIO/3301234 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): UNITE mothur release for Fungi 2. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301234

    Includes global and 3% distance singletons.
    10.0 2025-02-19 All eukaryotes 20 802 136 018 Current https://doi.org/10.15156/BIO/3301235 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): UNITE mothur release for eukaryotes. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301235

    Includes singletons set as RefS (in dynamic files).
    10.0 2025-02-19 All eukaryotes 20 802 245 787 Current https://doi.org/10.15156/BIO/3301236 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): UNITE mothur release for eukaryotes 2. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301236

    Includes global and 3% distance singletons.
    10.0 2024-04-04 Fungi 18 895 74 190 https://doi.org/10.15156/BIO/2959342 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): UNITE mothur release for Fungi. Version 04.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959342

    Includes singletons set as RefS (in dynamic files).
    10.0 2024-04-04 Fungi 18 895 140 300 https://doi.org/10.15156/BIO/2959343 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): UNITE mothur release for Fungi 2. Version 04.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959343

    Includes global and 3% distance singletons.
    10.0 2024-04-04 All eukaryotes 19 302 122 914 https://doi.org/10.15156/BIO/2959344 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): UNITE mothur release for eukaryotes. Version 04.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959344

    Includes singletons set as RefS (in dynamic files).
    10.0 2024-04-04 All eukaryotes 19 302 232 937 https://doi.org/10.15156/BIO/2959345 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): UNITE mothur release for eukaryotes 2. Version 04.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959345

    Includes global and 3% distance singletons.
    9.0 2023-07-18 Fungi 19 051 143 384 https://doi.org/10.15156/BIO/2938075 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): UNITE mothur release for Fungi. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938075

    Includes singletons set as RefS (in dynamic files).
    9.0 2023-07-18 Fungi 19 051 187 443 https://doi.org/10.15156/BIO/2938076 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): UNITE mothur release for Fungi 2. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938076

    Includes global and 3% distance singletons.
    9.0 2023-07-18 All eukaryotes 19 451 215 454 https://doi.org/10.15156/BIO/2938077 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): UNITE mothur release for eukaryotes. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938077

    Includes singletons set as RefS (in dynamic files).
    9.0 2023-07-18 All eukaryotes 19 451 307 276 https://doi.org/10.15156/BIO/2938078 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): UNITE mothur release for eukaryotes 2. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938078

    Includes global and 3% distance singletons.
    9.0 2022-10-16 Fungi 17 495 143 840 https://doi.org/10.15156/BIO/2483919 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE mothur release for Fungi. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483919

    Includes singletons set as RefS (in dynamic files).
    9.0 2022-10-16 Fungi 17 495 188 070 https://doi.org/10.15156/BIO/2483920 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE mothur release for Fungi 2. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483920

    Includes global and 3% distance singletons.
    9.0 2022-10-16 All eukaryotes 17 683 216 528 https://doi.org/10.15156/BIO/2483921 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE mothur release for eukaryotes. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483921

    Includes singletons set as RefS (in dynamic files).
    9.0 2022-10-16 All eukaryotes 17 683 308 588 https://doi.org/10.15156/BIO/2483922 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE mothur release for eukaryotes 2. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483922

    Includes global and 3% distance singletons.
    8.3 2021-05-10 Fungi 14 097 44 343 https://doi.org/10.15156/BIO/1265786 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): UNITE mothur release for Fungi. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1265786

    Includes singletons set as RefS (in dynamic files).
    8.3 2021-05-10 Fungi 14 097 83 993 https://doi.org/10.15156/BIO/1265829 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): UNITE mothur release for Fungi 2. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1265829

    Includes global and 97% singletons.
    8.3 2021-05-10 All eukaryotes 14 237 96 423 https://doi.org/10.15156/BIO/1265914 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): UNITE mothur release for eukaryotes. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1265914

    Includes singletons set as RefS (in dynamic files).
    8.3 2021-05-10 All eukaryotes 14 237 190 888 https://doi.org/10.15156/BIO/1265957 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): UNITE mothur release for eukaryotes 2. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1265957

    Includes global and 97% singletons.
    8.2 2020-02-04 Fungi 12 664 35 077 https://doi.org/10.15156/BIO/786381 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE mothur release for Fungi. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786381

    Includes singletons set as RefS (in dynamic files).
    8.2 2020-02-04 Fungi 12 664 71 723 https://doi.org/10.15156/BIO/786383 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE mothur release for Fungi 2. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786383

    Includes global and 97% singletons.
    8.2 2020-02-04 All eukaryotes 12 666 91 074 https://doi.org/10.15156/BIO/786382 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE mothur release for eukaryotes. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786382

    Includes singletons set as RefS (in dynamic files).
    8.2 2020-02-04 All eukaryotes 12 666 183 678 https://doi.org/10.15156/BIO/786384 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE mothur release for eukaryotes 2. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786384

    Includes global and 97% singletons.
    8.0 2018-11-18 Fungi 9 407 26 556 https://doi.org/10.15156/BIO/786340 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE mothur release for Fungi. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786340

    Includes singletons set as RefS (in dynamic files).
    8.0 2018-11-18 Fungi 9 407 61 931 https://doi.org/10.15156/BIO/786351 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE mothur release for Fungi 2. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786351

    Includes global and 97% singletons.
    8.0 2018-11-18 All eukaryotes 9 409 54 013 https://doi.org/10.15156/BIO/786341 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE mothur release for eukaryotes. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786341

    Includes singletons set as RefS (in dynamic files).
    8.0 2018-11-18 All eukaryotes 9 409 112 778 https://doi.org/10.15156/BIO/786352 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE mothur release for eukaryotes 2. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786352

    Includes global and 97% singletons.
    7.2 2017-12-01 8 997 21 699 https://doi.org/10.15156/BIO/587478 When using this resource, please cite it as follows:
    UNITE Community (2017): UNITE mothur release. Version 01.12.2017. UNITE Community. https://doi.org/10.15156/BIO/587478

    Includes singletons set as RefS (in dynamic files).
    7.2 2017-12-01 8 997 49 052 https://doi.org/10.15156/BIO/587478 When using this resource, please cite it as follows:
    UNITE Community (2017): UNITE mothur release. Version 01.12.2017. UNITE Community. https://doi.org/10.15156/BIO/587478

    Includes global and 97% singletons.
    7.2 2017-10-10 8 756 21 793 Download Includes singletons set as RefS (in dynamic files).
    7.2 2017-10-10 8 756 49 160 Download Includes global and 97% singletons.
    7.2 2017-06-28 8 747 21 809 Download Includes singletons set as RefS (in dynamic files).
    7.2 2017-06-28 8 747 49 407 Download Includes global and 97% singletons.
    7.1 2016-11-20 8 180 21 163 Download Includes singletons set as RefS (in dynamic files).
    7.1 2016-11-20 8 180 46 389 Download Includes global and 97% singletons.
    7.1 2016-08-22 6 285 19 698 Download Includes singletons set as RefS (in dynamic files).
    7.1 2016-08-22 6 285 47 408 Download Includes global and 97% singletons.
    7.0 2016-01-31 6 273 16 991 Download
    7.0 2016-01-31 6 273 37 020 Download
    7.0 2014-08-01 5 925 16 849 Download
    7.0 2014-08-01 5 925 36 878 Download
    7.0 2014-03-02 4 384 17 730 Download
    7.0 2014-03-02 4 384 37 921 Download
    6.0 2014-12-30 4 431 16 759 Download
    6.0 2014-12-30 4 431 41 231 Download
    6.0 2014-09-10 4 403 16 782 Download
    6.0 2014-09-10 4 403 41 271 Download
    6.0 2014-07-04 3 973 17 084 Download
    6.0 2014-07-04 3 973 41 596 Download
    6.0 2014-05-13 3 245 17 643 Download
    6.0 2014-05-13 3 245 42 454 Download
    6.0 2014-02-09 3 059 17 784 Download
    6.0 2014-02-09 3 059 42 917 Download
    6.0 2014-01-15 3 032 17 840 Download Includes singletons set as RefS (in dynamic files). Default clustering threshold for dynamic files is 98.5%
    6.0 2014-01-15 3 032 43 098 Download Includes global and 97% singletons. Default clustering threshold for dynamic files is 98.5%
    6.0 2013-12-08 2 441 15 325 Download
    6.0 2013-12-08 2 441 40 679 Download Includes global and 97% singletons.
    *Based on dynamic release
  • CREST release

    CREST release (download)
    Reference dataset for CREST (https://code.google.com/p/lcaclassifier/) based on the dynamic release (default: 98.5% similarity).

    List of all CREST releases
    Version no Release date No of RefS* No of RepS* Release status Link Notes
    7.0 2016-01-31 6 273 16 991 Current Download
    6.0 2014-02-09 3 059 17 784 Download
    *Based on dynamic release
  • Top50 release
    Top50 release (download)

    This is a FASTA release of the sequences of the "Top 50 most wanted fungi" paper. One representative sequence from each SH (singletons as well as non-singletons) is provided. Approximately 1,000 compound clusters are unidentified at each of the phylum, class, and order levels, such that this file contains significantly more than 50 sequences. Use this file if you want to find out if any of your newly recovered OTUs belong among the “most wanted” fungi. All these SHs are also present in our other release files; this is the release where you find only these "most wanted" SHs.

    Format (example):

    >Fungi|HM123225|SH221352.07FU|refs|k__Fungi;p__unidentified;c__unidentified;o__unidentified;f__unidentified;g__unidentified;s__Fungi_sp|UCL7_006587
    TTGGTTGGATATATTATAGCCTCTTG...
    
    HM123225 = GenBank/UNITE accession number of representative sequence
    SH221352.07FU = species hypothesis accession number
    UCL7_006587 = compound cluster accession number
    refs = this is a manually designated RefS
    (reps = this is an automatically chosen RepS)

    If you can improve the taxonomic annotation of any of the "most wanted" lineages, then please do so! Either by third-party annotation in UNITE or by writing one of the UNITE developers.

    List of all Top50 releases
    Version no Release date No of sequences Release status Link Notes
    8.2 2020-02-04 3 271 Current https://doi.org/10.15156/BIO/786374 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE top50 release. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786374
    8.0 2018-11-18 2 524 https://doi.org/10.15156/BIO/786342 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE top50 release. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786342
    7.2 2017-12-01 2 024 https://doi.org/10.15156/BIO/587477 When using this resource, please cite it as follows:
    UNITE Community (2017): UNITE top50 release. Version 01.12.2017. UNITE Community. https://doi.org/10.15156/BIO/587477
    7.2 2017-10-10 2 024 Download
    7.2 2017-09-14 2 026 Download
    7.2 2017-06-28 2 065 Download
    7.1 2016-11-20 2 299 Download
    7.1 2016-08-22 2 308 Download
  • General FASTA release

    General FASTA release (download)
    This release consists of a single FASTA file: the RepS/RefS of all SHs, adopting the dynamically use of clustering thresholds whenever available. The format of the FASTA header is:

    >Claroideoglomus_sp|AM076567|SH1229972.10FU|reps|k__Fungi;p__Glomeromycota;c__Glomeromycetes;o__Entrophosporales;f__Entrophosporaceae;g__Claroideoglomus;s__Claroideoglomus_sp

    This is the file we recommend for local BLAST searches against the SHs.

    List of all general FASTA releases
    Version no Release date Taxon group No of RefS No of RepS Release status Link Notes
    10.0 2025-02-19 Fungi 20 295 81 842 Current https://doi.org/10.15156/BIO/3301229 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): UNITE general FASTA release for Fungi. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301229

    Includes singletons set as RefS (in dynamic files).
    10.0 2025-02-19 Fungi 20 295 147 735 Current https://doi.org/10.15156/BIO/3301230 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): UNITE general FASTA release for Fungi 2. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301230

    Includes global and 3% distance singletons.
    10.0 2025-02-19 All eukaryotes 20 802 147 735 Current https://doi.org/10.15156/BIO/3301231 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): UNITE general FASTA release for eukaryotes. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301231

    Includes singletons set as RefS (in dynamic files).
    10.0 2025-02-19 All eukaryotes 20 802 245 787 Current https://doi.org/10.15156/BIO/3301232 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): UNITE general FASTA release for eukaryotes 2. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301232

    Includes global and 3% distance singletons.
    10.0 2024-04-04 Fungi 18 895 74 190 https://doi.org/10.15156/BIO/2959332 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): UNITE general FASTA release for Fungi. Version 04.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959332

    Includes singletons set as RefS (in dynamic files).
    10.0 2024-04-04 Fungi 18 895 140 300 https://doi.org/10.15156/BIO/2959333 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): UNITE general FASTA release for Fungi 2. Version 04.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959333

    Includes global and 3% distance singletons.
    10.0 2024-04-04 All eukaryotes 19 302 122 914 https://doi.org/10.15156/BIO/2959334 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): UNITE general FASTA release for eukaryotes. Version 04.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959334

    Includes singletons set as RefS (in dynamic files).
    10.0 2024-04-04 All eukaryotes 19 302 232 937 https://doi.org/10.15156/BIO/2959335 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): UNITE general FASTA release for eukaryotes 2. Version 04.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959335

    Includes global and 3% distance singletons.
    9.0 2023-07-18 Fungi 19 051 143 384 https://doi.org/10.15156/BIO/2938067 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): UNITE general FASTA release for Fungi. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938067

    Includes singletons set as RefS (in dynamic files).
    9.0 2023-07-18 Fungi 19 051 187 443 https://doi.org/10.15156/BIO/2938068 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): UNITE general FASTA release for Fungi 2. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938068

    Includes global and 3% distance singletons.
    9.0 2023-07-18 All eukaryotes 19 451 215 454 https://doi.org/10.15156/BIO/2938069 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): UNITE general FASTA release for eukaryotes. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938069

    Includes singletons set as RefS (in dynamic files).
    9.0 2023-07-18 All eukaryotes 19 451 307 276 https://doi.org/10.15156/BIO/2938070 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): UNITE general FASTA release for eukaryotes 2. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938070

    Includes global and 3% distance singletons.
    9.0 2022-10-16 Fungi 17 495 143 840 https://doi.org/10.15156/BIO/2483911 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE general FASTA release for Fungi. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483911

    Includes singletons set as RefS (in dynamic files).
    9.0 2022-10-16 Fungi 17 495 188 070 https://doi.org/10.15156/BIO/2483912 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE general FASTA release for Fungi 2. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483912

    Includes global and 3% distance singletons.
    9.0 2022-10-16 All eukaryotes 17 683 216 528 https://doi.org/10.15156/BIO/2483913 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE general FASTA release for eukaryotes. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483913

    Includes singletons set as RefS (in dynamic files).
    9.0 2022-10-16 All eukaryotes 17 683 308 588 https://doi.org/10.15156/BIO/2483914 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE general FASTA release for eukaryotes 2. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483914

    Includes global and 3% distance singletons.
    8.3 2021-05-10 Fungi 14 097 44 343 https://doi.org/10.15156/BIO/1280049 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): UNITE general FASTA release for Fungi. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1280049

    Includes singletons set as RefS (in dynamic files).
    8.3 2021-05-10 Fungi 14 097 83 993 https://doi.org/10.15156/BIO/1280089 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): UNITE general FASTA release for Fungi 2. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1280089

    Includes global and 97% singletons.
    8.3 2021-05-10 All eukaryotes 14 237 96 423 https://doi.org/10.15156/BIO/1280127 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): UNITE general FASTA release for eukaryotes. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1280127

    Includes singletons set as RefS (in dynamic files).
    8.3 2021-05-10 All eukaryotes 14 237 190 888 https://doi.org/10.15156/BIO/1280160 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): UNITE general FASTA release for eukaryotes 2. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1280160

    Includes global and 97% singletons.
    8.2 2020-02-04 Fungi 12 664 35 077 https://doi.org/10.15156/BIO/786368 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE general FASTA release for Fungi. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786368

    Includes singletons set as RefS (in dynamic files).
    8.2 2020-02-04 Fungi 12 664 71 723 https://doi.org/10.15156/BIO/786369 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE general FASTA release for Fungi 2. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786369

    Includes global and 97% singletons.
    8.2 2020-02-04 All eukaryotes 12 666 91 074 https://doi.org/10.15156/BIO/786370 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE general FASTA release for eukaryotes. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786370

    Includes singletons set as RefS (in dynamic files).
    8.2 2020-02-04 All eukaryotes 12 666 183 678 https://doi.org/10.15156/BIO/786371 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE general FASTA release for eukaryotes 2. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786371

    Includes global and 97% singletons.
    8.0 2018-11-18 Fungi 9 407 26 260 https://doi.org/10.15156/BIO/786343 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE general FASTA release for Fungi. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786343

    Includes singletons set as RefS (in dynamic files).
    8.0 2018-11-18 Fungi 9 407 61 635 https://doi.org/10.15156/BIO/786353 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE general FASTA release for Fungi 2. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786353

    Includes global and 97% singletons.
    8.0 2018-11-18 All eukaryotes 9 409 54 013 https://doi.org/10.15156/BIO/786344 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE general FASTA release for eukaryotes. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786344

    Includes singletons set as RefS (in dynamic files).
    8.0 2018-11-18 All eukaryotes 9 409 112 778 https://doi.org/10.15156/BIO/786354 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE general FASTA release for eukaryotes 2. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786354

    Includes global and 97% singletons.
    7.2 2017-12-01 8 996 21 699 https://doi.org/10.15156/BIO/587475 When using this resource, please cite it as follows:
    UNITE Community (2017): UNITE general FASTA release. Version 01.12.2017. UNITE Community. https://doi.org/10.15156/BIO/587475

    Includes singletons set as RefS (in dynamic files).
    7.2 2017-12-01 8 996 49 052 https://doi.org/10.15156/BIO/587475 When using this resource, please cite it as follows:
    UNITE Community (2017): UNITE general FASTA release. Version 01.12.2017. UNITE Community. https://doi.org/10.15156/BIO/587475

    Includes global and 97% singletons.
    7.2 2017-10-10 8 755 21 793 Download Includes singletons set as RefS (in dynamic files).
    7.2 2017-10-10 8 755 49 160 Download Includes global and 97% singletons.
    7.2 2017-06-28 8 746 21 809 Download Includes singletons set as RefS (in dynamic files).
    7.2 2017-06-28 8 746 49 407 Download Includes global and 97% singletons.
    7.1 2016-11-20 8 179 21 163 Download Includes singletons set as RefS (in dynamic files).
    7.1 2016-11-20 8 179 46 389 Download Includes global and 97% singletons.
    7.1 2016-08-22 6 285 19 698 Download Includes singletons set as RefS (in dynamic files).
    7.1 2016-08-22 6 285 47 408 Download Includes global and 97% singletons.
    7.0 2016-01-31 6 273 16 991 Download
    7.0 2016-01-31 6 273 37 020 Download
    7.0 2015-08-01 5 925 16 849 Download
    7.0 2015-08-01 5 925 36 878 Download
    7.0 2015-03-02 4 384 17 730 Download
    7.0 2015-03-02 4 384 37 921 Download
    6.0 2014-12-30 4 419 16 759 Download
    6.0 2014-12-30 4 419 41 230 Download
    6.0 2014-09-10 4 391 16 782 Download
    6.0 2014-09-10 4 391 41 270 Download
    6.0 2014-02-09 3 056 17 782 Download
    6.0 2014-02-09 3 056 42 914 Download
    6.0 2014-01-15 3 029 17 839 Download Includes singletons set as RefS (in dynamic files). Default clustering threshold for dynamic files is 98.5%
    6.0 2014-01-15 3 029 43 096 Download Includes global and 97% singletons. Default clustering threshold for dynamic files is 98.5%
    6.0 2013-12-08 2 441 15 325 Download
    6.0 2013-12-08 2 441 40 678 Download Includes global and 97% singletons.
    5.0 2013-10-15 2 502 15 891 Download
    5.0 2013-08-27 2 334 15 986 Download >FASTA header format:
    >Glomeraceae|AM076560|SH146432.05FU|refs|k__Fungi; p__Glomeromycota; c__Glomeromycetes; o__Glomerales; f__Glomeraceae; g__; s__uncultured Glomus
  • Full "UNITE+INSD" dataset
    Full "UNITE+INSD" dataset

    This FASTA file ("UNITE+INSDC") comprises “all” fungal ITS sequences of the UNITE and INSDC databases present in UNITE Species Hypotheses, updated and released some four times a year. Locked UNITE sequences and low quality (and overly short) INSDC sequences are however excluded. The format of the FASTA header is:

    >UDB016651|k__Fungi;p__Basidiomycota;c__Agaricomycetes;o__Thelephorales;f__Thelephoraceae;g__Odontia;s__Odontia_sp|SH1146664.10FU

    Download "UNITE+INSDC" dataset here.

    List of all "UNITE+INSD" datasets
    Version no Release date Taxon group No of sequences Release status Link Notes
    10.0 2025-02-19 Fungi 2 069 189 Current https://doi.org/10.15156/BIO/3301227 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): Full UNITE+INSD dataset for Fungi. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301227
    10.0 2025-02-19 All eukaryotes 2 930 276 Current https://doi.org/10.15156/BIO/3301228 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): Full UNITE+INSD dataset for eukaryotes. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301228
    10.0 2024-04-21 Fungi 2 030 075 https://doi.org/10.15156/BIO/2959330 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): Full UNITE+INSD dataset for Fungi. Version 21.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959330
    10.0 2024-04-21 All eukaryotes 2 882 691 https://doi.org/10.15156/BIO/2959331 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): Full UNITE+INSD dataset for eukaryotes. Version 21.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959331
    9.0 2023-07-18 Fungi 6 499 364 https://doi.org/10.15156/BIO/2938065 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): Full UNITE+INSD dataset for Fungi. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938065
    9.0 2023-07-18 All eukaryotes 8 381 941 https://doi.org/10.15156/BIO/2938066 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): Full UNITE+INSD dataset for eukaryotes. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938066
    9.0 2022-10-16 Fungi 6 441 764 https://doi.org/10.15156/BIO/2483925 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): Full UNITE+INSD dataset for Fungi. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483925
    9.0 2022-10-16 All eukaryotes 8 380 474 https://doi.org/10.15156/BIO/2483926 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): Full UNITE+INSD dataset for eukaryotes. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483926
    8.3 2021-05-10 Fungi 1 039 010 https://doi.org/10.15156/BIO/1281531 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): Full UNITE+INSD dataset for Fungi. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1281531
    8.3 2021-05-10 All eukaryotes 1 927 778 https://doi.org/10.15156/BIO/1281567 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): Full UNITE+INSD dataset for eukaryotes. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1281567
    8.2 2020-02-04 Fungi 714 329 https://doi.org/10.15156/BIO/786372 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): Full UNITE+INSD dataset for Fungi. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786372
    8.2 2020-02-03 All eukaryotes 1 796 591 https://doi.org/10.15156/BIO/786373 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): Full UNITE+INSD dataset for eukaryotes. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786373
    8.0 2018-11-18 Fungi 887 395 https://doi.org/10.15156/BIO/786347 When using this resource, please cite it as follows:
    UNITE Community (2019): Full UNITE+INSD dataset for Fungi. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786347
    8.0 2018-11-18 All eukaryotes 1 464 820 https://doi.org/10.15156/BIO/786348 When using this resource, please cite it as follows:
    UNITE Community (2019): Full UNITE+INSD dataset for eukaryotes. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786348
    7.2 2017-12-01 777 113 https://doi.org/10.15156/BIO/587474 When using this resource, please cite it as follows:
    UNITE Community (2017): Full UNITE+INSD dataset. Version 01.12.2017. UNITE Community. https://doi.org/10.15156/BIO/587474
    7.2 2017-10-10 777 046 Download
    7.2 2017-06-28 736 375 Download
    7.1 2016-11-20 673 903 Download
    7.1 2016-08-22 656 899 Download
    7.0 2016-01-31 536 881 Download
    7.0 2015-08-01 475 641 Download
    7.0 2015-03-02 442 706 Download
    6.0 2014-12-30 442 802 Download
    6.0 2014-09-10 410 527 Download
    6.0 2014-07-04 410 537 Download
    6.0 2014-05-13 406 159 Download
    6.0 2014-01-15 376 803 Download FASTA header format:
    >UDB000001|"INSDC organism"|"INSDC lineage"|"UNITE taxon name"|"UNITE lineage"|"Species Hypothesis code".
    6.0 2013-12-08 377 092 Download
    5.0 2013-10-15 353 307 Download
    5.0 2013-08-26 353 464 Download FASTA header format:
    >UDB000001|"INSDC organism"|"INSDC lineage"|"UNITE taxon name"|"UNITE lineage".
  • UCHIME/USEARCH/UTAX/SINTAX reference datasets
    UCHIME reference dataset

    This is a release of UNITE/INSDC representative/reference sequences for use in reference-based chimera detection of fungal ITS sequences in UCHIME and similar programs. It consists of several datasets:

    1. The file "*original*" is meant for chimera detection of more or less full-length ITS sequences and is designed to suit the needs of the average user and the kind of ITS datasets typically used in fungal systematics. The sequences were trimmed to remove any larger chunks of SSU/LSU as applicable.
    2. The folder "untrimmed_ITS_sequences" contains a FASTA file with untrimmed ITS sequences. This file can be used to tailor chimera reference datasets to suit particular needs, such as including only truly full-length ITS sequences or including 25 base-pairs of the SSU/LSU in the sequences. The ITSx options "--partial" and "--anchor" switches can be used to accomplish this.
    3. The folder "ITS1_ITS2_datasets" contains ITS1-only and ITS2-only versions of the reference dataset; these files are recommended over the "*original*" file for chimera detection in amplicon-based ITS1 or ITS2 datasets.

    Reference: Nilsson et al. 2015. A comprehensive, automatically updated fungal ITS sequence dataset for reference-based chimera control in environmental sequencing efforts. Microbes and Environments (paper).

    Download UCHIME reference dataset here.

    List of all UCHIME reference datasets
    Version no Release date No of sequences Release status Link Notes
    9.0 2022-10-16 161 335 Current https://doi.org/10.15156/BIO/2483933 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE UCHIME reference dataset. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483933
    7.2 2017-06-28 30 555 Download
    7.1 2016-12-01 29 342 Download
    7.0 2016-01-01 22 774 Download
    7.0 2015-03-11 22 219 Download
    6.0 2014-07-26 21 059 Download

    USEARCH/UTAX/SINTAX release (download)

    Reference file for USEARCH/UTAX/SINTAX. For optimized parameters and further information, please refer to the UTAX UNITE page. This is the "dynamic" release of the UNITE species hypotheses system, with singleton species hypotheses included. Any parts of the 18S and 28S are left in these sequences. This reference file can be used for ITS1-only or ITS2-only sequences if parameters trained on ITS1 or 2 only ('taxconfs' files) are used. ITS regions can be extracted using the ITSx tool.

    List of all USEARCH/UTAX/SINTAX reference datasets
    Version no Release date Taxon group No of sequences Release status Link Notes
    10.0 2025-02-19 Fungi 168 030 Current https://doi.org/10.15156/BIO/3301245 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): UNITE USEARCH/UTAX release for Fungi. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301245
    10.0 2025-02-19 All eukaryotes 266 589 Current https://doi.org/10.15156/BIO/3301246 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2025): UNITE USEARCH/UTAX release for eukaryotes. Version 19.02.2025. UNITE Community. https://doi.org/10.15156/BIO/3301246
    10.0 2024-04-04 Fungi 159 195 https://doi.org/10.15156/BIO/2959340 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): UNITE USEARCH/UTAX release for Fungi. Version 04.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959340
    10.0 2024-04-04 All eukaryotes 252 239 https://doi.org/10.15156/BIO/2959341 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2024): UNITE USEARCH/UTAX release for eukaryotes. Version 04.04.2024. UNITE Community. https://doi.org/10.15156/BIO/2959341
    9.0 2023-07-18 Fungi 206 494 https://doi.org/10.15156/BIO/2938083 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): UNITE USEARCH/UTAX release for Fungi. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938083
    9.0 2023-07-18 All eukaryotes 326 727 https://doi.org/10.15156/BIO/2938084 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2023): UNITE USEARCH/UTAX release for eukaryotes. Version 18.07.2023. UNITE Community. https://doi.org/10.15156/BIO/2938084
    9.0 2022-10-16 Fungi 205 565 https://doi.org/10.15156/BIO/2483923 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE USEARCH/UTAX release for Fungi. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483923
    9.0 2022-10-16 All eukaryotes 326 271 https://doi.org/10.15156/BIO/2483924 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2022): UNITE USEARCH/UTAX release for eukaryotes. Version 16.10.2022. UNITE Community. https://doi.org/10.15156/BIO/2483924
    8.3 2021-05-10 Fungi 98 090 https://doi.org/10.15156/BIO/1280276 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): UNITE USEARCH/UTAX release for Fungi. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1280276
    8.3 2021-05-10 All eukaryotes 205 125 https://doi.org/10.15156/BIO/1280317 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2021): UNITE USEARCH/UTAX release for eukaryotes. Version 10.05.2021. UNITE Community. https://doi.org/10.15156/BIO/1280317
    8.2 2020-02-04 Fungi 84 387 https://doi.org/10.15156/BIO/786375 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE USEARCH/UTAX release for Fungi. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786375
    8.2 2020-02-04 All eukaryotes 196 344 https://doi.org/10.15156/BIO/786376 When using this resource, please cite it as follows:
    Abarenkov, Kessy; Zirk, Allan; Piirmann, Timo; Pöhönen, Raivo; Ivanov, Filipp; Nilsson, R. Henrik; Kõljalg, Urmas (2020): UNITE USEARCH/UTAX release for eukaryotes. Version 04.02.2020. UNITE Community. https://doi.org/10.15156/BIO/786376
    8.0 2018-11-18 Fungi 71 042 https://doi.org/10.15156/BIO/786345 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE USEARCH/UTAX release for Fungi. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786345
    8.0 2018-11-18 All eukaryotes 122 187 https://doi.org/10.15156/BIO/786346 When using this resource, please cite it as follows:
    UNITE Community (2019): UNITE USEARCH/UTAX release for eukaryotes. Version 18.11.2018. UNITE Community. https://doi.org/10.15156/BIO/786346
    7.2 2017-12-01 58 049 https://doi.org/10.15156/BIO/587476 When using this resource, please cite it as follows:
    UNITE Community (2017): UNITE USEARCH/UTAX release. Version 01.12.2017. UNITE Community. https://doi.org/10.15156/BIO/587476
    7.2 2017-10-10 57 916 Download
    7.2 2017-06-28 58 154 Download
    7.1 2016-11-20 54 569 Download
    7.1 2016-08-22 53 693 Download
    7.0 2016-01-31 43 293 Download
    7.0 2015-11-06 42 004 Download

UNITE collaborations: third-party trait datasets

Põlme, S., Abarenkov, K., Henrik Nilsson, R. et al. FungalTraits: a user-friendly traits database of fungi and fungus-like stramenopiles. Fungal Diversity 105, 1–16 (2020). https://doi.org/10.1007/s13225-020-00466-2

fungaltraits aka funfun: a dynamic functional trait database for the world's fungi.

FUNGuild: An open annotation tool for parsing fungal community datasets by ecological guild.


Web services

Web services for fetching UNITE data are described in PlutoF API documentation. For any complements/issues please contact info@plutof.ut.ee.


UNITE Classification

NB! From Version 7.0 onward UNITE follows fungal classification published in Fungal Diversity, May 2018 (https://link.springer.com/article/10.1007/s13225-018-0401-0).

Future UNITE versions will have alternative classifications connected to the SH datasets and user can choose one or many to be used in analyses.